Description :
From Genome Similarity Track
Location :
Scaffold_17:235065- 241040
Transcript NameFunction/comments
Pytul_DAOMBR144PYU1_G007110Similar to TBC1D7: TBC1 domain family member 7 (Homo sapiens)
Pytul_DAOMBR144PYU1_G007109Similar to NIPBL: Nipped-B-like protein (Homo sapiens)
Pytul_DAOMBR144PYU1_G007108Similar to NIPBL: Nipped-B-like protein (Homo sapiens)

Sequence
5975 bases(100 bases per row)
AGCAAAAATGGCACTGAATCGCAACTTCCGCACGACGTACTACAAGACACTGGGCGTGCCTGTCATGCAGCGCATCGCCATGTACGCGTCGCTGTTCGGT
GATCCTGTGGTGAGCCGCTCCAAGGTCATGAAGCTTGTCCAGGAGATTGGCGTGCCGTCTCAGTACCGCGCGATCGTGTGGCAGTTACTCGCCGGTGTGT
TGCCGCCGTATCCATCGCTTTGGGAGTTCGCGCTCGAGCAGCAGCAAGAGATGTTCCAGGACATAGTGGACGCAGCGCAGGTTCTTTGTCCCAGTGCAAG
AAGTGAAGATCGTCAGTTGTTAATGAATCCGACGAACATGCAGTCAGAGTCTCCAAGTTGCACCTGGCGAGAAGGCGACGATGCTGGTGACAATGGCGGC
ACGGAGAACGAAGCGGAGCTTGGGACCAAGACGAGTAGCATGTTAGAGCGCTGTCACTTGATCCGATTGCACCGGACATACTGGTGCGAGATCCTGGCGC
ATCAAGAGCTGCTGAATGGAATGCAAGACGAAGAGTTCTTGGATGCGGTCGCTCGGATGGTGTGTGATGTGTTCGGCAGTGAGATGGAGCGCTTTTGGTG
CTTTGTGAAGCTTGTCGATGTCTTCCATGACGGTCTCTCCCAGTTGCGACCAGTAGTGCCGCTGCAATCGTATCATGGAGTCAGTGTTTCGGAGTGTGAA
GTGCTGTTCCTCCGCACTTTGGATGCGCTGAAGAAATCCAACGAATCATATATTACGCACGCCACGCAGTGAGAAAATTAACTCATATCACTCAGCAAAC
CCTTCCACAAACTCTACATCGTCGTCGTCAGTGCTCTCGACATGCTTGGGCTGCATCAATTTGCGCCGGCGGCTGCCCTTTCTTCTCCTAGTCTTGCCGC
TGCTGTTCATCATTGCAACATCTTCTTGAGCTTCAAAGTCCATTCGGTGCTGGTCGTCGCGCGCAGCTTCCCACGCGTGCACAAAAACGTGCCAGCTCCA
CTCAATTGGGTCTTCGGCTTCAGGGAGAGAAGGCACTTTCAGCTTTGATGTCCGTCCGGACTGCATCGTGGGTTGCTCCGTTGCCTGCCAAACGCAGCGT
TCGATAAAGAAGTGGTGTATCAGTAAGCCGTAAAATAGACCAAATCGTGAAGATGTAATGGAGATCATGGTTGCACTCACCTTTGACGAATTTCCTGGTT
GATACGTCATGCACTTCTCGTTTTCGAGCTGGTACATATTCTTCAGATGAAATTTCACGCGAATCAACAAACTGACCGCGAATGCGGCACAGCACACTGT
CTGAAGACGTCTGGCGTCGTCTTTTGTTGGCTGCATGGTAGGGATATAATCCGCGATGTCGACGTCCGAAAAGTCTGTGTCTTCGTCTTCCATAATATCA
GAAGGAGCCCCCGCGTGTGCAAAGAGCTCTTTGATGTTATCGAGCGTCGGTCTACACATTACGTACACAGAGCAATTGCGTTAGATACATGCTGTCATCA
GGTATTAAGTACATGTAGTCAACAGTACCGTACCCGAGCTTGAGTGTGACGACGCGGTTGATCAAATAAATAATGTAGAGAGGCTCATCCTCTAGATCGT
ACGGCAAAGCCGAGATCAATTGCGCCAGGTAGCATAAATATTGTAAGGTGCTTCCCATGGGCACAAGTGAGCTTGGTTTCGCATTCTTATTTCCAAGCAT
GCTTCCTGAGTCAGAGAACTGGTTCACCAGCGCTTTCAGGAACATGTTGCGCTGGGCTTTTGCCGTGCGAATGCAATTCGAGTAGAGCCTTCCGAAAAGG
CAATAGTCGTGCTTGTACTTGTCTTTTGTGTACACTGAGCTGGTTCCAAACGCATTCAGCTGGAAGGAGTGCGATAAAAAGATGCCTTGAATCGAAGGAG
TATTCAGCAGCATCGGAAACTTCTCGTGCAATGCCACCAACTGGCTATGTGCCAAATCACGAATCGAAACGACTTGGTCCGTCTCCAACGCCACCAGGTT
CGGGATGCAATGCACTGGACTCACCAGTCCTTGTGTTAACAGGGTACTGATGCATGTGACAGCCTCAGTACGGATCCTAACTGGTTTTTGTAATGCCAAC
ACCAGGATATTTTGCAGCTGCGCCTGCATGACACTCCCAATGAGAGCAGCATCAGCCTCTTGATCTCCTTGCACCTGTTCATTTTTGCTTTTCGTTGTGT
TCATTTTCTCCGTGGCTACTCCATGCTCCAGCCGCTGCTCTTCATACTTCAACAACTCTCTCAAGCTCGTCAAGCATTGTAGTTTCATTTCATCTGGAGA
TTCTGCGAGCAAGAACTCCAAAATGTTGTCTTGCTGTGCTTGAAGAAGAAGTCGCGGACGCGTGAGAAATAAAAAGCCTAGTCCTTGGACAGCCTTCGCC
GAACATGCTGTGTCTCCTCCCATCCACAGAAACCGTGCAAATGTTTCGTAGAGCGATTCCATTACTGCTCCTTTCTTGAGTTTTGTTGCCTCACTGATCT
GAAAGTCGTAGGTGTCCAAATCAAGGGTGCCTCCGACTTGTCCAGCCGTAAACAATGCTCGCTGTAAAGATGAGCTGGCGTCTGGTCCAATGTTTGCCAA
GGAGTCGAGATCTTTGTACTTCAGCAAATAGGAGTAAAATACTTCCAAGAGCTTCATCAGCAGAACAGGGGGTTTCCTTGTGCTAGTAGATATCGTCGCG
AGACATTTAATGCTTGGGCCAACCACGCTTGGCGGTGCTCGAAACACCAAGGTCCTTAAGTCATCCTCTAGTCGTTTGACGAGCCGCGGAGGAATTCGCT
CCATTTGTGAGAAAACATTGTTTACCATGGACAAAACAAGGCTTTGCACTTTGTTCTCAACTCCCTTCTCCAGCTTCTCATCACCAACCAGGTGCACCAT
AATCAGTTCCAAGTACTGATGGAGTAGCATTGGCTGGGCTTCGCAAAACGCCGATAGCGTCTCCATGCACGACACGAACTGTATTTGGATGTCTCCAATA
GTAACCCCTTTAAGCGGTTCGCCTTCTTCAAGCTGCCAAAGACAGCTCGTAAGGCATTCCACAATCTTCTCGGAGCGCGCTTGAGCAACCTTGACCTCGT
CTGACCGATCTCTGTTGAGCCGTGTACCATTTTTCGATAATTTTTCTTGGTCGTCTTCATGCAGCAACCGTCTCAGAAGGGCAACAAACCAATCCAGGTT
CGGCATGTCGTGGATCACCTCAACTATTGTGATTACTATTTGGCGAACGTCATCTTGCTTCGAACGCTTGCTCTCAACAATGCTTGACGGAGTGATTTGT
GGTGTACGATACGCTGACCATGCTTGATCACGCGAGGAAAAAACTTTACCATCGGGAGAAAGAAATTCAAGAATCCTGACTCTTTTGGTGCTAGATTGCG
GCGCAGGATCGTTGTTCATTGAAGTGCTCTCCACCGATCTCCATCCTGGGGGTAGCTCTTCAGTTGGGAGCTCGTCCACAAAATCACTTGAAAGTTGTCT
CGCTGAGAGCTCCGATCCGAACCAAACCTCCTGGAACGTGTCAATAATGAAATTTTTGACAAGAGTTTCTTCTGACGGATCCCCGATGCGCTCAACCAAG
CTTCGCATGCATGCACTCTTGCGCCTCAGCTCTTCTTCCGAAATGGAGTCCACTTCGTCCTTGACATGAGACACCGATATGAGAAACGCTCGAAAAGTCT
TGCACACACTCTTTCGAACGCTGATGCCTTTATCCCGTAGGCGCTCTGCTAAAATGTCGAAGTATCTATCAAACTGCACAAAAAAAGGAAAGGAATTAGC
ATGTAAGAGTTCACCTGCTAGACAAGAACAACAATACGTACCAGAAGAGGTTGGAGCGTCACGTATCTTCCCACCAGGTCTACTGCTGCCTGACGAACCG
AGGTACTTTCGTCTAAAAAGCATCGCTGAACTGCCTCACGAACACCACGCTCAGCCATCAGCATCGGATCTACGTCAACAATCCCTGCCAGCACCTTCAA
AACTCTGGCTCGGAATGTTGGTATCCCCTTCGACAAAAGTGACATGACATGGGCGAGCAGCTTGTCGAACAGACAACAAAACTCGCGAGTAGTGGCCAGG
TGTAGGCTCAACTTCAGACCAAGACTACCACTTGGCGGTGCTATTTTTGACACGCTTCCAGGATTAGTATCCCAAAATGTCTTCCAAAGGGACAACTCTG
TCTTCCAAAGCGACGACTCCTCCGTGATATCGTCGCGCTTGGCATCATAACTCGCGCAAGACTCGAATATAAATCTTGCCAAAAGCAATCGTCTCGAGTC
AGCTTGCGCGATGTTTAAGCGATTGCTTCGTCTCATGAAAGCCATCACAGCATGCTTCAGTAGCATTTTATTGTTATCATCCAAGCGCAAGAGATCTTCA
TCGCTGTCGAACTTCGCTTCAGGAATAACCTTGTTCAGATGTCGTGCGTGCTCTGCTAGGACTGACCGGGCATCCATATCGTCTTCCAGTATTTCACGCG
CTGCAACATTTTGGCACGTTTTGATCGACGTGCAGATCTTTCCGATCAGATTGAGTGCCGTCACAGTGTGCTGTGATTCCAACTTTTTTAAATCTTTTGT
CATGTTAGCATGCAAGATGCTTGCAAGCGACGAACTCACTGTCTCCAAGAGCACCTCTGCACCCGCCCACTCTGGTCGAACGAACATCACAAGAAGATCT
TCCACAAAATTCTCCAAAACCACTCTGTGATTACGCTCGTCGTGTTTTTTGAAGCACTCCTTCACCAGCGAAGCAGTGAACAATCGAGTGTTCTGCCGTG
TCTCTTCCAGGCATCTCGCAAATTTCTTCTTCTCTGACTCAGGTCCTTCATCCAAGTTATTCGAAGACATGAGAGTCGGATCTTGCGCAGCGTGGCTTTC
AGCACCTTCGTTTTTAACTTCATCAATTGACGCACTTGACTGTATCAACGCAACCACGAGTGTGGAGATCATCTGGATGCTGTGGCTGGAGTCCAATAAC
TTGACATTTCGCAAAGTGCGCTTTGATGTTGGTAATTTCACCATAATTGCAACAACTTCATCCAGCATCAACGGACGATGCGCCTTGTACTGAATGAATA
TACCGCGCAAGACCGCAACTGCACTTTGTTGAAGCGATGTGGCAAACGAGCTGTGCTCCAACAAAAACAGCTCAGTCATTGATGACGAGAAGTGCAGAAT
CCACCGATCCGCGAGTTTCACCGTCAGAACCAATTTGGACAACTGCTCAATGAACTCGCAAACGACAGGGACCAAACGATCAATTGCCTTTCGAATGTCC
CTGTTTGTTTTGATGTTCAAATACTTTCTGCGTCTTTGTAGCTGAGACTTGGACTGATCACTGTGGGTTTCTTGCCTTGTTGCAGTTTCTTCGGGATGAG
AAGCTGCTGTCGTACGGGTCGAGTCAATGCAGGGCACAATCAATCGCTGGATGATGTGATTGAAAAGCTGGATACAGTTGTCGATCATTTCTTCTGATAG
CACCCGTCGGTCGATTTCACGAGTTGACAACACAATAAGCTCGCAGATCCCAACATCCAAGCACAGCTGTAGGCGCGCAATGAGGCGAGCGTCGATACCG
GACGAACGCCATTCATCGTCGTCATTACTTAGCATCATCGCCCCAAGGATGTCCAATCCTATGCCATGAAGCACCTGCATATTTCGTAGCAAAAAGGCAC
ACACCGTTAAATACATGCAAGCCACCAAGCAACCTCAGGCAGTTACAATTACCTGTTTGTCTAGGGTCTTCATGAGTGTGATTAGCAGATCAGGATCCAC
CTTGCGGATCATATCTCCTTTATGCATAACTTTCAGCGACTGCAGCAAGGTTTTGACGTCAGGTGCCGTGAACAAATCAACCCCATCACGCTGGAAGGCT
TCCATTTGCTCTCGGCTGTGCAACTGATTCAGTAGCTCACTAAACATGTCAGAATATTTCTCGACGCTTCCAGCA