Description :
From Genome Similarity Track
Location :
Scaffold_18:23505- 28176
Transcript NameFunction/comments
Hyaar_Emoy2803164hypothetical protein

Sequence
4671 bases(100 bases per row)
CGCTAACCATTCCAGCAGTGCTGTCTTTGTCACCAGGTGAACACCACCTGACGGCGTATCTAGTGTTGCAACGAGAATGTTCGTGATCAGCGGCTGGGTG
TGAGTATCTGCCAGTTCAGAAGTATAGAAACTCAATAGCATCGGAAGAACGTGGCGGCGGACAAGCAGCACCACGTCGTCATCGGTGCGTATGCCGCGAC
GAAGTGTGTGAAGAAGCCATGATCGCTCTTGCCGAAAAGTTAGAGGTGCCCGGCTGTTGAACAGCGAGTAGAACATTGGCACATCAGCCACATCCATCGC
GGGCCGCGCCAGCAGGAAGTGATTCACTTGCGGGTACAGCACATGTGTCGGACGCGTTAAAACAGCCAAGGCGTCATTGAGAAACACCGTAACTAGCGAC
GGCACTTGCTTCAGTTCCTCCGCGATTCCACGGCGGAATACATCCAGCAAAAGATGCACCTGGCGCCCTGCCTTGAAGTCGCTCGACGTTTCGGATGGAG
CTTGCAACGACTCATGTACATGTGCTAAGATGCCGAAAGCATACTTGCGCATATCCTCAACACCAGACGACGTAGCACGAATGGCAACTCCCAGTAATCC
TTGCTGCACGATGCCACCATCAGGCAAGTTCGACGACGAGATAAAATGCGACAGCATCGGCAGGAGGAACGCGGGGTCGTAGCCTTCTATTGGTTGCTCA
CCATCAACAACCATGGCCTGCGCAGCTTCGTCACTAGTATCGCCAGCAAAGAAGTCTTCGTTTAGATTCAGGAGATATGTATCGCTAGTTGTTGAAATTG
TACGCGTTAGCGGGAAGTGCTCAATAGTGGCACGAACACGATCTTGCTCAAGACCTCCTCCGAGAACCCAGGCTGAGTCGTCAACCAAGTCGTTGTGAGA
CCCTTTCGATGACACTGGCATAGCAGCTGCTGGCAAAATCGTAGAAGATGCACCAAAGCGGAAGCCCATGCTCGCCAACGTAAGGCCATCTATCTTCTGA
GCTTCAAAATCTTTAAACAGCACCCGCAAACTGCGATCGAAAGGTGAAAGCGACATCGAATATGAGGCCAGCAGTATCTGCAAGAGAGGACGAGTATATT
TCCCAGTAATGCGGACAAGTTGCGCAACCACCTGAGCGATCAAGAGCTGTACTTCTTTGTTCTTGCCATTTTGTAGACTCGTCGTGAAGCACGGGTGTTG
TACGACCGCATCAAAGTGAGCTACAAAATCGTAGTCGATCGCATTGGCGTCATTCTCCGCTAGACGCAACAACGCCGCTGTCAAATCCACAAACTCCACG
AACGCAAGCTTGCTCGTGCTTTCTCGGACACCTTCACACATCGCAGCAAAAAGTGGAAGAACCAGTTTTAAAGCTGACAACTGCTTCTCGGGCACTTGAT
GCTGCAGGTATCCGATAACACTCCCCACCAAAAGCATCGTGGCCTCGAAATCATGAGGCAGGCTATCACATTCGCTTTCGGCATGCTGGTCCAATTTGGT
TTGCGCTGCCTTCAGACTACCCACTCCGCTTCGAATAAGGATTGCCAGCAGATCTACGACATTACTGTCATCAAAACCGCTGCTGCGTGATAGAAAGAGA
AGGGCAAGCAGCTGCGAGGACGACAAAGTCTCATCACATTGAGAGCTCGCTAACTCCTGCAGCGCGGCACCAAGAGATGCACCGAACGTATTTGCGTTAC
CACTCGAGGACGCATCAGTACACAGATGCCTTACCAGTGCAAGCTCTGCGGTACATCCTTCGTGAGACTTTAGTAACACACGCTGATAACAGGCTGGGAT
CAAGTCGTCAGAAAGTTGACGTAGCTCAGGATGCACGACTCGCGCGAATACATCATATAGCGCCCCTGCCAATCGAGATACCACTCGCTGATCCGTCCCA
TGCTGAATCTGCTTCCAGAGCTGCTCCTCAAAAACGACCGGAAACGCCGCAACCTCTTCACCGCTTCGAAGAGCTGCGATCATTGCTTTCATCATTTCGG
TGCAGTGGTTACGGCTTGACGTCACGTGCGCACTTCGCACCATGAGGGGCACAAGGGAAGTCGCGATAAATGGCAAGGCTGTTGAGGCATCGACACCACC
TAGCTTTCCCAGTACCGTGAATCCATCCATAAGAAATGGCAGCTTCCGCTGGCTGCTTTCGCTGCACAGTAGCAGCCAGAGCTTCTGCTTGAGCAACTTC
GTGCGCTTATGGACGATAATCGATCGGAAATGCTCACCCATCCCACGGTTTCGAAGTGATTTGAGTACACACTCGACGAGTACTGCGTGTGGAGCGGTAA
TAATCAGAGCACTGGACTGCTGTAGAAGACTGTAAAGTACTGGAATACGAGTACTGTAAGGAACACGTGACGCTAACACAGCCACGAGGGGCACGCCTGC
GCGTTGAAACAGATCACCGAAATCGCACAGCGTTGCCAAGTTTGAGTCCGGGTTAATGCTGGAGTAAACTCGCAAAGCCACAATTTTTACGGCATATAGC
TGACGCCACGAGCCAGAGCTAGCATTACTGGAAATTACAGCTTGAAGTTTGAAGAAAATACGTGAAACGATGTTGGAGGTCAACCCGTTTTCACCGTGAA
CAATGCAGATCGTCAGCAAATTTGAAAACAGCTCACAAAGTCGCGAGTATCCGTTTCCGGAGAAGCCATGGTTCCTTAACGCGAAAAAGAACAGTAGCTG
TTCGCACATGCGCGCTGCATCCGTTGCTGCCAACCGATTATTGTCAACTCGACTCTTCACCACGCTCATCATCACAGCAATCGTCGAGTCTTGGTCGTTG
CAGTCTTGATTGGAGATGCGGAAAAGCACATGCTGAAGGACAATGTACAAAGGAACTACCTTTGTAAATGTTTCAGCAGGAGACGAATCGGACGTCTGGC
GTTGTCGTCGATCTTTGCTTATCGTAACCAATTGCGTCACAGGTTGGCTTAACAGCGAAAGAATGTCTACGTCTCCTCTTCCGGACAGGTAGTGAACAAT
GGGGCCGAAATTTGCTGCTGCTTCAGCGCAGTTGCTAACAATGTGATCCCAGGATGTAACGAAGCTCGATGGCGTCATCTCAAATAATGCGGCAGTCAGC
GTATTGACGTCACTATGACGGTGCCACTTCATGCCAGCATTTTTGGTCCCCTCTCTAGGAGAGGCAATATTGTTGGACTTGCACGTTTCGGATACAAGTG
CATCGCAAGTCATCTTAAGCCACATGTAAGCATCACCTTCACATAAAATCTTATCCGACCGCTTTCGCTTCTTGTTTTTCACATTGTTGCTGCAGGTATT
GTCGTCCTCGTTTCGATGCATTTTCGGTGCTATAACCATATCCGCAAAAGCATCGTTACTTGCGATCAACGCGACCAACTGCTGGGGATGCTTGCTGGTT
GGCATCAATGCTAGCAAAATACGTACAGCAAACGCTACGACACACTTGTCAGCACGATATGCAGACAGGTCCGAACTCCCAGCTACTCCGCTGCGCGAAC
TGAGAAATTCAACCAGCGCCACAGTTATTGGACTGAGAGAAGACGAAGCGGCTGTTACCACACGGCTACCAATTGCGACATATTTGAGTGGATCGGCCAT
CACCGCACATGCGAGCTGTTCTGTAAATAAAGCGCAGACCTTCCCTCCACCCTGACATAAACTCTCGAGCCAGAATGAAACTTCATCGTTTGCAAGACCA
GCAATATCGTGTCTCTCTTCTCCTTGCGTTGTCAGCCCAAAGATGTCCGAAGCCCGCAAAGTTCGCCGAAGCACCTGACATGCAAGCTCTTGCACGGATA
AACTTGAAGTTGAGACGTACAATAACAGCATCTGCTGGAGCCTTGAGCGATGATTAGAGCTACCACTGGTGAAGAGAAACCGCAGACGTGAGGTGTCTAT
AGCTAGCAGAAATCGCAATATCTCACTAACGATCAAGCTCTGCAGAGGTGTCGTCAACACGACGCCCTCAGCACTATTATCGACAGGGCAATCCAGGTAA
TGCCACGTCAGCATCTTCGTGAAATCAACCTTTATCTCACGCATTGCTTGGGGAAGACACTCCATGTAGAGGCGAAACACTGTGAGAGCGCGCACGTAAA
CAAGTGCAACGCTTCGCTGTTGTGAGGCACATAACTTAAGCAACAACGAGACAAGCGCCTCCGGGCTCGGTAGAAGAAATCGTAGCTCCGAGCACACTTC
AGAAGCAAAGCCCGGCGATGGCAACATAGGGGCAACACGCACAAACCGATTCAGTATCGCCTCAATTACACAGAGACACGAGTAGACCACTAAGTTGCTG
TTGTGCTGGATACCACGGGAGAGCTCCTTGCGGAAGTTTCCTGGCGCAATAAGCCGAGACGCTAAGATCTGAGGAGAACACCACGATTGCAGAGCGTCTT
GATTTTCGTTCGTGGGCATTCCCACCGCCATCGCATCCAACGAGCACGACAGCAGTTTCTGCACTATCGAAGCAACACAGAACCATCGGAAAACTGGCTT
CGGCTCAAGCTGAAGTGATAGCGCAGCAAGGTATTCCGACAAAAACCCTGGGTACTCTGCAAGAAACTGCATCACAAGCGCTTGTGCTTGTGCACTGCGC
AAAAGTTCGTTCACACCAATTGTCGCGACAGCATTCCGAATCACCTTGACTGCGTACACTTCTTCCGACGT