Description :
From Genome Similarity Track
Location :
Scaffold_134:23502- 25489
Sequence
1987 bases(100 bases per row)
GCGCCTTCCGAGCAGCCAGCAGCAGCGGGCGTCGAGCCCTGACGACCGCGGCCCGCATCCAGCACCAGCGTCCGGTCTTGCCAaCCGCCAAGACACTCGA
AGTAGGCGGCAACTACACTCTCAACTACCTCGATATCACTCCACCGCAaGgCCAGTCAGCCAAAAcaCCGACGTTCGTGTTCATCCACGGCGCACCTGGC
TCGTTCCAGGATTTCAAGTACCTCATTCCTTTGCTGCAGGACAAGGCGCGAGTCATCGgCATTAACCTTCCTGGAAaCGGAGACTCCAAGGTGTTGGACC
GAGATAATTACTACAACCTGATCAAAGCCCAGCATGTCCACAGAGCTGCGTACGACGCACTTACTGAACTATGCTCTCCAGATGAACATGTCTTCGTTCT
AGGACACTCGTTCGGTGGCCATGCTACCATTAACGTAGCGGCTTTCAATGAGGAAGAGCGCAAACTCAACATTCAAGGTATGGCGTTGGTGGCGTCCGCT
GGCCTCCGTCCTCACAAGGCGATGCagCCAAGGACAAACGCGATTGTCTGGAAGATGCTGCGCTCGAACTTGACCGTCCTCGAGAaGTTCGCCCGTGAGC
TGATCAAGCAAGTGTACACCAAGGTCTTGCGCTTCCCTAACAACGCGCCCACTGAGCACTACGTCGCCGGCATCGTTCGCTGCGCTACCACCGACTTTAG
CGAGATCAAGGAGCGGGTAGAGCGCGTCCGCCACGTTCCAACGTTCTTCGCGTGGGCTCGCGACGATGCATTCATGGAGGAAGAAGTGTTCCTCGAGTTG
AGCGACGCTTGTCATTCTGGGCCTCGCTACGCATTCACGAAAGGCGGCCACAACATCCAGAAGACcAAGGCACCTGTtCTCGCGAAGGAGCTGTGGCGCT
GGGCACTTGGAGTCATGAACGGCGACCCCGACgCTCGCACCCAGCAGGTCAtAGAGCAtCCcTAATGATcTAGGTTAATAGACGCCATGCTGACGCATGC
ACTTGTTGTCGACTGTGAGTTGCCCACTTTGCcAAAAGCGTCGCCATCCGCCGTCATCCCATAaTGACGCTCGTGCGCCGGCTTCCGCACACCCAAACGA
CGCGCGTGCAGGCTGCTCGCGCGTTCGCGTCGCTGCGCCGCCCAGAGCTGCCGgCtGCCCaGgAGCTCGACGTGCGTGGGGCATACAAAATCAAGTACAT
CGACcTACCCCcACCAGCACGCCCTTCTCCGACGATCGTGCTGATCCACGGCTCTCCAGGCTCATACCAGGATTTCAAGTACTTGAtCCCGCATCTCCAG
GAGCACGCGCGCGTGATCGGCATTAACCTCCCAGGTAACGGTGGCTCCcAAGTGCTCGATCGAGCAAACTACTACGACAATTTGCGTGCGATCAACTTGG
GCCACGCCGCTCACGACGCCATTGCTCAGCTCGTCACGTCTCAAGACGACGTGTTTGTGTTGGGCCACTCGTTCGGAGGCCACGCGACTGTCAATGTCGC
TGCGATTAACGAGAAGGTTGGTGATGTGCACACGAAGATCAACATCCGCGGCGTCGCGCTCCTGGCGCCTGCGAGCCTACGTCCGCACAGAGCTCTCCAa
TTCGGTAACATCGGGATGCTGTGGAAaCTACTCACGTCCGACTTCCCACTCGTGGAGCAGGCAGGaCAGGCGTTGACACGGGCACTGTACACGCGCATCT
GGCGTTTCCCGGCAAAGGAGAACACCGAGCACTACGTCGCTGGTCTCGTCCGTTGCGCCAGCACCGACTTCGGCATTATCAACGACCACGTCAGCCGTGT
CAAAGATGTACCAGCGTTCATCGCGTGGGCCAGAGACGACGCATTCATTGAAGAAGAGGTGTTCCAGGAGCTGagCGAGGCGTGTCATCCAGGTCCTCGC
TTCGCCTTCGAACGAGGCGGCCACAACATCCAGAAGACTAAGGCTGAGTTCCTAGCGCACCAGCTGCTCCAGTGGACGCACCAAGTC