Description :
From Genome Similarity Track
Location :
Scaffold_856:2350- 4490
Transcript NameFunction/comments
Phyta_totarag11047conserved hypothetical protein
Phyta_totarag11048hypothetical protein

Sequence
2140 bases(100 bases per row)
GCACCAGTTTTTCGTGTACGAGATTTTGCGAGCGAACCTTGGTTCACTTTGAGCCAGCCGTACGCATTTCATATATGCTTGGCTTAAATTATTTGCTTGT
TAAACCACCCTCCGTTTACTTGCGAACCATCCGACATTTTGCTCGGAAAAATCTTTTCTCTTCTCGATAGACCAGTGATGCCTCTGCACATAGGCCGACC
TCGACGCGCTTGGTCGAACAATCGCTGACCTTAGTCGTGGCTGCTGGGCACAGGTGGAGCGCCGGCGATGTAGCGCATCTTGCGAGGCGGGTTGCTGAGC
TGGTGCACGTGGTACCCGGCCGACATGGCTCCAGCCGTGGCGATCAGCGCCAGGGCGCGCTGCCCCGTGAGAACTGCGCGTCGGCCCATAACGCTGGTGA
TGACGCCCGACATGGCCAACGACGTGCCGTGCTCGAAGTGGTGGTCCGTGATGGTGTCCGTGAGCACTAGCAGACCGGCGCCCAGAAACCCAACGCCCAA
CACCATACCTCCCACGAGCGACGGGGTGTGGTGCTTGAGCGCGTAGCCAGCACCGCCCGCGAGGCCCAGGATCGTGGCGTACGTGAACGCTTGATGCTGC
CCTCCTGCCATGTTGACTACTGACGTGAATTTGACCTTTCAAAACATATTTATTAGCAGCTAGAGGCATATCCTGCaggtgaaggcgaaggctACGGAGT
CTGCGGCGGCGCCAGGCCGGTCCTGTACATCACCTCTGGATAGGTTCTAAGTCGTAGGAGTAAGGCAACATGCTGGAGCTCGGTCCAGGCACCAAGGAGC
ACTTCGACTACATGCGCAAGATCCGGCGGAGTGTCACGGCAAGCTCAAGCCGTGACGAGCCACATGCTTTCAACATCCATCGACTGCAGCCCTTCGTGAA
ATAGCTTGTACATACAATGCTGCAGAGCTAACATTTCCTTACACTGACTGTCTACTTGGAGCGCATGATGTGGCGCAGCTCGACATCGAGGATCTCCGtg
accttgagctgcatCTTGGCCATCTCCTGGCAAGCGCAGACCTCTTCCACCTCCGGCAGAAAGCGACAGCAGGACGAAGCCACGTCAAAGTGCTCGAACG
CCTCGCTCGTGCGACCCTGAGCGAAGAGCACTTGGGCGATGTCTAGATGCGCCGAACTGCAGCGAGGGTCCACTTCAAGCGCCTGCTTGAAGTGCGCAAT
GGCTCGCATGGGATCGTTCGTGCCGACATACACGCGACCAGCGTTCAGGAATGGCAGCGGACACTGCGGCGACAGCTCCCAGGCGGTCAGGAAGTGGCGC
ATCGCGTCGGCGTAATTGCCTTGGTCGGCCAGCACCTCGCCGTGGAACAGATGCACCTCAGCAGACTCCGGGAACTTCTTCGAGGCCTCCTCGAACACGT
CCTTGGCTTGGTACGTGGATCCGCTCTTGTAGAGAGCCATACCATAAGACACGTGGGTGACCGGAAGGGCGTCGGACCGCGAGatgcagcgacgaagaca
ctgCGCAGCCTTGTAATAGTTGCCGTCAAGTAGCTCCATCTGCCCCAAGTGCAGGTACACGTCTGCCTCGTTCGAGTCTAGCTCCATGGCCTCGGAGAAG
CACGACGTGGCCTCGTCCGTCTCGCCAATTTCTGCCAGAAACCCACCCTTTTTCACCAAGGAGTTCACCAGGGTCGGTTGAAGCTCCAGGCTTTTGTTGA
TAACTTCCACCGCAGTGTGCACGTCACCCGCAACgtacagcagcgacgcatGTAGGTTGAGTGCCAAAGCGCGATCCTCCACTGAAAGTCCCTCGGCCTC
CATGTCCTTGGTCACCAGCGTCCAGATGTCGCGTTGCGCTTCACCATAATTCTTAGTGCGTTTGTAGTGAATCGCGCGATGAAGTAGCGTGAGCGCGTCC
AGGTCTGACTGCTCCACATCCTCCTTCTTCGCGATATCGAATGGTACACGCGCAGCATAAtcagcgtcgtgttcgaACGACTCAAAGTAGCTATCCACCA
GCCACGAAGACGGAAGTTCGTGCAACTTTTCCATGTCCGCGAACAGAGTCTTTGCCACACGTCGACCCACCAAACGCGACGCACGGTCAATGGACTCGGC
GTGATCCGGCGAGCGCGAACCATCTAGAATGAAGGACGTC