Description :
From Genome Similarity Track
Location :
Scaffold_189:235- 3061
Transcript NameFunction/comments
Phyta_totarag5310hypothetical protein
Phyta_totarag5311hypothetical protein

Sequence
2826 bases(100 bases per row)
NATATGGCTAGTGGCTTTTGGGCAGTACCGATGACGCTAAGAGCAAAACAAATCTCAGATTTCATTTGTCCGCTCGGTCATTTTCAGTGGACGCGTATGC
CGTTAGGTTTGAAGAATGCACCCCTGATCTACCAGCAGATGCTTGATAACTGTCTCTGGGGATTCATGCTACTTTCGCCCAACGAGGAAGCTCAGATGGA
CGCTGAAGTGCTGGAGTTCATGGGAATTGAGGCAGATGCCTCAGTTGACAGTGGCAAAATGCCAGTGCTGTCTGAAGAACTAACGGTGTTCCGAAGGAAT
ATCCCAACCCCACCTCAGCTGAATCCGGTCTTGGGAAGAAGTTCCTACATCGATGATATCGCGTACGGAGCTAAGACCTTGGATCAGATGTGCATTGACC
TGAATCGTTTGTTGTACCGACTACGCTACTTGGTCATTACGGTGAGCTTGCCCAAGAACGAGTTTGGCAAGATGGCAATCTCGTATTTGTCTCATGGGAT
TGGATCGGAAGGGATCCGAGCCAAGCCGAAGACCGCCAAAGGTGTGGGAAACCTGCCATTTCCGTCAACTCTGAAGGGGGTGCAGTCATTCCTGGGAAGT
CTGAGCTATTACAACGAGTTCATTGAAAATCTTCCGGTCGTGGCTTCAGTGCTGTACGAGTTGACCGACGAACTGATTCGTGCTGGTCGAGACCTCAGCC
GTGCCAAGGAAGCCTTTGAGAtcctgaagcagaagatcaacTCTACCCCGTTGCTCAGACACCCAGATAAGGAGAAGCCATTTGTGATTATCATTCACGT
TAATCCTTGGGCAGTCAGTGCAGCGCTGGGTCAGGAGTACGACAACGTAATCCTCCCAGTGCGATACACCGGAAGAGTGCTTCATGATCAGGAACTCAGG
TATCACCCGACTGAGAAGGAAGTGGTAGCTTTCCTCATAGTCCTCAGAATATTCTACACGATACTGGCCGATAGCAAACTGCTGAAGGTATACACGCGTT
ACTCAGTACTGAAGTGGATCTTCAGGTCTCAGTCTCTGGAAGGACGCTGCGAGCAGTGGGCCGCAATACTAGTGCCATGGCCGTTGGAGATTCACAAGAT
CAAGTCAGATGAGGGTGGTTTAGCCGCGATCCTGGGAGCTGGGATCACTTCAAGAGACCAGCTCGATAAGGTCGCAGAGAACCTCATCCCAGCCAAAGGG
ATCGTTGTCCAAGCCCCACGGATCAGTCTGGAGATGCTTGAAGCGGATTAGGAAGGGTGACTGCTCAGTTTCGATGGAGCCGTCAAACTCTCAGATCGGC
GAGGCAGTTCCGGATGCGTCTTGTGGAGACTTTCGTCCTGGGATGTGATATAAGCTCGAGGATTTCACTTTGAAGGTATCACAGTGAATGAGGCTGAATA
TCATGGTCTAGTCGAAGGAAGTCAGATGGCGCTCGCTCGCGGGATCTCGGAACAGGTCGTAGTAGGAGACTCTTGCATTGCTATTCACCAGGCTCAAGGT
TTGAGTCAGTGTCTGGAGCTGgggttgcagttgctgctcatcgAGTTTCAGATGATCCAACCAAAGTTCCAATCGTTGAAACTTGTGCATGTTAAGCGCG
AATACAATGCCGCGGATGACTAGCTCACGACTAAGACGTTGATGGCTCAAGGCCCAGCTGTCATTGATGACCCAGTTGAATCGGCTCAGCTGAAACAGCT
GAACCAGATTCCTGAaaagttgatgaagataGCTAAGCTAGAGCTCAAGGCACCCGAGACGGGTCGATCTGAGGTAAATGAAGCCAGGGACGTTGTAGCA
GAACCGATGTCcgtagaagcagcagctgagccAATGGCCCGACTGCCAGGATTTTTGTAGTAACCCGGAACCAAACCGGAAATAGAGTCACTGATAAAGG
AGCCGAGGGAGTCAACACGCTTCCGAGACTGAACGCTCCTGTAGCTGAAGCATACGTGCCAGAAGAAGCAACGCCCGTTGCGTCAATTTCTGAACGATGG
CGCAGGATCCTAGCTCAACAAGAACCTGAGCCCTGGACTCAGAAGCTCAGAACCTATCTGAAGGGTGATTTGGGAGAACTGTCATcggctgaagctgaag
ctgaagaagtggcGCAGGTGGTGGATCAGTTCACTCTGGATTCTCGAGATGTGTTGTATTATCTGAGTCGACCTACTCCGAGCCGTCCCAGAGATGCAGC
TGGACGTCTGAGATTAGTGGTTCCCTGGTCCCTCAGACAAGACTTGATGCAGCTCACCCACGAGGACTTTCAGGGTGGTCATCAAGGAACCTCGCGAATT
TTTGAAAGGTTACGCCAATAGTATTACTGGCCTGGAATGGACGCTGACATGGAACGTTACGGTGTGGATTGCGTCACGGCCAAAGGAGCGCCACCGAACC
CCGGAACCTCGCCCGGAAATATCTTAGCGACACGTCCATTTGAGGTAGTATCCATGGATTTCGTCACGCATCTACCCAAGACTGATCGAGGCAACGTTTT
TCTACTGTTGTTTCAGTGTTCGTTTTCCGGTTTCGTCATCTGCAAGACTATGAGCACCACAACGGCTCAGGAAGTTGCAGAAGCATACATAGAGTGCGTT
TTCCAGAAGTTTGGAGCAAGTGTCATGCTTCGCCACGACAGAGATCCGAGATTCATGAGCGAAGTGTTCACCAAGTTTGGGAGATACTTGGAAGTCAACA
GCGAGCCACCTTAGCGTATCGACCTCAGGCCAATGGTCAACACGAGCGATATGTACAGACGGTAGTccgagctgtacgagcaTATGTTTCGGAACCCGAC
CAAAGTAACTGGGACGACcaagtgga