Description :
From Genome Similarity Track
Location :
Scaffold_3186:235- 2402
Sequence
2167 bases(100 bases per row)
GGTCGCGACACTGAAGAGCCACGAGCACATCCTGATTGCTAGTGGTAACGCGCTGCCGCCACCAGCCTACGGCGCGGTATGCGATATGGACACACAGGGG
CACGCCCCAATTAAACAGCGTGCCCGGCGCGTGCCGCTACGATTTCTAGGCAAGTTGTACGAGCTGCTGCGCGCTCTGTTGCGAGCAGGACTGATCGTCT
TTTCAGATAGTCCATGGGCATCGCCGATCGTGATTGTGATGAAAAAGAACGGGCTGGACATCCGGCTCTGCATTGATTACAAGATGGTGAATTCTATCAC
CGCGATCATGGAGTATGCAATGCCGCTAGTCGACGACCTGTTAACAGATCTCGAGCGCTACCTATGGTTCTGCTCGCTGGATGCAGCAAGCGGCTTCTGG
GCGGTCATGATGACCTTGCGAGCGCGTAAAGTGTCGGCATTCGTCTGCGCACTCGGACATTTCGAGTGGTTACGCATGCCCTTCGGGTTAAAGAACGCCC
CGATGATCTACCAGCGGATGATTGACAACGCACTCTGGGGGTTCATTCAACCTAAAGGAGGTTGGTTTGAATACTCGGAGAGGATGCGTTTAGCTGAAGA
ACAGGCCAAGGAACGTCGTGGGCCAAGCGCAGAGGGTTCGTTTCAAACGAAGTTCGCGGCAGACCGCGAAGCACCGGTAGTGACCGACCCTGTACTACAA
CTCGTCAACAGCCCCGTCGCTGACATGTTTACGAACGGGGAACCGGACGAATCATCGCTGGTACCTGTTTTTGGTCGACGGTCGTTTGTGGATGATATTT
GCTTCGGTGGCGAGGATTTCGACAGCTGCCTGGCGACGCTGGACCGATTGCTGGCCAGGTTTGCACAGTGTCGGATCAGCATTAGCTTCACCAAGAGCAT
CTTCTGCCAACCCAAGGTGGACTTTCTGTCGCATAAAATTTCGCCAGAAGGTATCAGAGCTGACCCCAAGAAGCTTGCGGCCATCACCGAGCTTTCGTTT
CCAACGAGTAAGAAGGGCATGCAGTCGTTTCTTGGAGCGGTTAATTACTACAGTCGCTTCATTCAAGACTTCGTGGTCTACGGTGCAGCGCTGTACCAGC
TCAAGGATGAAGACTTTGCCCTTGAAGGCGGCCTTTCTGTGGCACGTCGTTCTTTCGAAAAATTGAAGACGAGTGTTTCACATTCACCCATCCTCAGGCA
CTTCGATCGGTCGAAAGCAGTTCACGTCATGCTCTTTGCGAATGAATGGGCGTTGAGCACTACGCTAATGCAAGAACATGAAGGCAAGTTACACCCCGTA
CGGTTCCTCGGTCGGGTGCTTAAGGAAGCCGAGATGAACTACCATCCTGCTGAGAAGGAAGTTTTGGCGTTACTTCTGCTGTTGAAGATCTGTTACGTCC
AACTGGCAGGAAAGACGCTACATGTCTATACACGATTCTCGACTTTAGAGTGGGTGCACAAGTCGAAGTCTCTCTTTGGACGCGCGGTCCAGTTCGCAGT
GCTGCTATCGCAGTGGCACTTGAAGGTGCAGCGCGTGAAGGAGAAGGATGTCGCCTTCGCGCAGCTACTGCAGTCAAGCATCACGAGCTTCGTCGACCTG
GAAGACTCGCTCGCGCCGGTGGCACCTCCACACAAGGGTCCCCCGACTATTCGAATGGACCCCGCGTTGCTGTACGCCAAGCTTTCCCGTAATTACAGCG
GATTCGTCATGTCTTTTGACGGATCAGCGAAGACAGAGAAGTACGGTGGCTACGGGAGTTGTTCATGGGTGCTGTGGAGCCTTCCTGAGTGGAAGGTAGT
GATTGCTGCAAACGCTTACCTCTCGGCCACCACGGTGAATGAGGCAGAGTACACAGGTATGATAAACGGTGTCAAGGCTGCTATTGCGCACGGTGCCGAG
GATTTAGTCATCGCTGGTGACTCAAGACTCGCGATTCAACAATCACTAGGGGTGATCGCATGCAGGAAGGAAACTTTGCTAGCGCTGCTGAATACTCACA
AGGAACTCACGGCCAAGCTTCGATCAGTTAAATATCTTCACGTTGTACGAGAATACAACGCGGCCGCGGATTCGTTAGCCACTGAAGCGCTGGAATCGAA
GGTCAGTCGGGTAATCTTGGCTGAAACTCGCAAGTCGGAATTGGCATCGCTGAACCGCATCCAGGAA