Description :
From Genome Similarity Track
Location :
Scaffold_2137:235- 1711
Transcript NameFunction/comments
Phypl_g14723hypothetical protein

Sequence
1476 bases(100 bases per row)
GCGTGCAGGCATTTCTTGGAGCCCTGAACTACTATAGCCGGTTCATTCAGTACTTGGCGTTGTATGGGGCTGTCCTCTATCCACTAAAAGAAGACGACTT
CACGGACGGGGGTGACTtggctgctgcccgtgcttCGTTCGACGAGTTGAAGCGTAAGGTGATTGACGCCCCGATACTGCACCACTTTGACTCAGCGAAG
GAAGTCCACGCCATGGTATTTGCCAATGACTGGGCACTCAGCAGTACCACGGTGCAGATGCATGACAGCAAGCTGCATCCAGTCCGCTTCTGTGGTCGCG
TCCTCAAGGAAAACGAGATCAACTACCACCCAGCCGAGAAAGAGGTGCTGGCACTGTTTCAACTCTTGAAGATCAACTATACGCTGGTAGCAGGGAAGAC
TATCCATGTCTACACCCGCGTTGACGTGAACACCCATTCCACGTTGGAATGGGTGTTCACGTCAAAGAATCTTTACGGACGTGCGGTGAGTTTCGCTGTA
CTGCTCTCTCCATACCACCTGAAGATCAAGCGAGTGGGAGAGCGCGATGTAGAGTTTGCTCAGCTTTTACAAGCGACTATTACTCCGTCTATTGGGCTCG
ACGAGTCGCTAGCTCATATGGCACCACCATCCATGAACTCAGCGAGTATTCGGATGGATCCTGAGCTTCTTTACGCTCACGTACAGCCAGACTTCCACGG
GTATGTGCTGTCATTCGATGGGTCAGCCAAAACTGAGAAGTATGGTGACTGTggcagctgctcgtggattTTGTGGCGTCTACCTACGTGGGATATTGTg
atcgctgcgagtgctcACCTGTCGTCCACCACAGTTAATATCGCTGAGTACACCGGGATGAACCACGGTgtacaagcagcagccgaccGTGGTGTCACCG
ATTTGATCATTGTGGCAGACTCCAGGTTTGCAATCCAGCAATCCATGGGGGTGATCGCATGCAGGAAGGATTATCTACAAGTCGAGCTAGCACGCTACAA
GAaactcgtcgagcagctcaattCAGTACGCTACCTGCACGTAGTTCGTTGCTATaactcagcagcagacgcactGGCGACGGAAGCATTAGAATCCAAG
GCCGGACAAGTCGTCCTCAGTAGCGACCGCAAGACGGAACTACAAGCTCTTAACAGGATTCAAGAGAAGCTGTACACCGATGGGTCAGCGAACAAGACCC
GAAAATAACCTATAGTCTCGGCGACTACCCGGAGTCAAACTCGCCAAGGTCGTCGAGTCAGATTCGCCGATCAGGGGCTTGACGACTCAGCGAGGGAACA
ACCAGAACCGATTTCACCCGCAGATGAGACCTCGCCAAGTCCTTCGACCACCGACAGCTCGGAAGGCAAATTTGAAGCAATGTATCAGCCTCCAGAAGCT
CGGCGAGTGGAAGCCCCAGCCAGGACTGCACCCGAACGCCAAGAATCGCCAAGTGCGCTTGATGTTGACCCACTGG