Description :
From Genome Similarity Track
Location :
Scaffold_719:235- 1674
Transcript NameFunction/comments
Phymu_g11701hypothetical protein

Sequence
1439 bases(100 bases per row)
GGTCTGCATTCTCTTTCTGGCGGTCAACGGCAGCGGCTATCGCGTCGCGAATGTAGCGGATGACCGAATCCCGCCGGCTCACGAAATCTTGTACGGCCGC
AGCGTCGCTTCGCTGCGGCACCTCGTTGGGCGCAAAGTTTGCTGGGGGCGACTCGGTAGCCACGGCCGGGTCCGGAGCAGCGTGAAGCTCAACTGCGCGA
CGCTGGCGCGGGTTAATCAGCGTCCGACTGGTCCAGGCGGCAACGTctcgtgaagaagcagtcgCCACTCGCGCGGCGGCTCGTGTAAGGGGACCCTGGC
TGGAGACCCGCGAGGAAGACCTCGTGCTCACCGCGTTCACATTCGAGTCAGCGGCCAGTTCGGGTGTCGCAGCGGAGTCGCTACCAGTGGAAGTGGGAGC
CTCAGCTTCGTGGGCCCCTGACAGCTGAGACGGAAGGGGGCGCTCCAGCCCAAGGAGCGCCGGAACACGCGGATGACGTCCAAAGTTGACGAAGAATGGC
GTCAAGCCCGTTGATGCGCGCACGACGTTGTTGATTGCGAACTCGACCATGGGCAGGAACGTGCTCCACGACGTAAACGAcgtggcgaagctgctgagta
AGTCTTCGACGACGCGGTTGGCGCGCTCGGTTTGGCCATCCGTCTCGGGATGCGACGCGGTGGACATACTCAGCCGCGTCCCAAGTagcttgaagagctc
tcTCCAGAAGGCGGACGTGAAGCGAGGATCCCGGTCCGACACGATCGAGGACGGAATGCCGTGGTGGCGGTACACCacgtcgacgaagagcgcAGCGGAT
TGTTGTGCAGTGATCGTAACTGCCACAGGAGCGAGATGGACCATCTTGCCGAAGCGGTCGGCGAAGACGAGGATACCCGTACGACCTCGAGTGTCTCGAG
GTAAACCGAAGACGAAGTCCATGTTCACTGATGACCATGCATCAGTAGCGATTGGGAGCGGTCGGAGCGGAGCCTGCTTTGACGGACTTGGCTTTACGCG
TTCACGCTTCACACGAGCGCACCCACTTCCGCACCCATTTGCACAATAGAAGTCGCGAGAGAGGGGCGCAAATGTCTTCTCGCGACCAAGGTGACCAGCG
CTTGGGGTATCGTGGAACTCGTGGGTCAACCGAGCTCGGAGGTCATCGTCAAGCGGAACGACGATGCGGGGAGAGTCTTCTTGGTCGACGCGATACGTCA
GCAGAGCGCCATCAAGCGAGTATCGGCTGACGCGAGCGCGTGCCCCTGGGGACAACTTTCGCTTGGCtgtgtcgctggagctgcgcagGAACTCGATCAG
CTCGGAACAGGACGCGTCGTCCTTGTACGCGTCGGCGTTCAAGGCGCGTAGCGGAGTGGTCGCTGTGacctcaacagcagcgacgccttCAGCGATACAC
ACAGCAcattcgtcgtcgtcttcgtcgtcaccgaCTGCA