Description :
From Genome Similarity Track
Location :
Scaffold_2156:235- 1661
Transcript NameFunction/comments
Phymu_g13923hypothetical protein PHYSODRAFT_398253

Sequence
1426 bases(100 bases per row)
GTCGATCTACTCAGCTGCCTAtaccagttcttcgctggGCCGATCATTAGATCCGCGAAGGTGAGACACTTTTCCTCCTCAGTGGCCTGGTCTCGCTGGA
ACGCGGACTTGACCTTGCTGATCCAAGATCGTGCTCGATCTTCGTCGAGATCCTTACCGGCGAACTCTTTCAGATCCGAGATCGCCGAGATCCCGACTCT
CTGGATCACTGACgatcctcctcgtccgatCGCGGCCGAGGCCACAGCTGCCGGGCTCGTTGTCTTCCTTGCCGAACTCGGGAGCCCGAGACCATCGGGA
TCATACTCCCAAGAGTGCTGATCAGGGGTCCCGACGGGCTCCATGTCGACATCCTGCGCCCCCAAGTACTTGGGGCTGTTGATCAGCTTGGTCGGCGTGA
AACTTTGCTCCTTCAGGAACCGGTTCATGGCCATCTGGAAGTATTCGTCCAACTTGTTGCTAGATCCGGACGAGTTTGTCGTCGGGGTAGTCTGATCAAC
CGTGATCCCGTGGCCTTTTCGTAAGTCGGGTGATCTAGCGAGAGATCGCGGTCCGGAAGATCGTTGAtcttgcttcttcatgcgtGATCTTAACAGTTTG
GCTCCTGAAGGACCCAGCGACATTCGTTGGAATCCTCTCGAGCTGTCCGTATCTGGTTCTGATGTCGCGGACGCGTAGTGCGATGATCCTGTCTGGTAGC
CGGGATCAGGTATCTGTGATCGCTCGCCGACCAAGATCTTGAGGGCGCTGAAAAGATCTCGGGTCGCAGACTGGATCACGCTCAGATCCATGTCGAACAG
GGAGTTCGGATCGAAATCGCCGGCCACTAAGCCTGCCTCTCGAAGCAGATTCATGAGGATCTTCACTGCGACCAGGCGGTCGGTAGCTGATTGTGGATTC
GATACCGATCCTGTTAGATCTCCGATCTGGCGGACTTGTATGGTCGCGAGAACGGGACCTTGTAGCAGGACCTCATTCAGCACCTTCCGGTAGTACGCCT
GCTCAATCGTGTCTTTGGTAGCGGTAACTCGCGACGTGGTCGCATCTTTGACTTCCGAACCTGGAGCGTTCGGCTTGGTCCGGGTAGGCTTAgtctactt
cttcttcattggTCTGGATGCGACCGTGTGTTTTGTGAGCAGATCAGGTTTCGGCTTTACCAATTCCTTATCACTCGGGCGCGGATCTCGATTTTCATCA
GGATCCGCAATGGCCCCCGAAAGAGCTGAATTCGAGGCTTTACTTCTAGATCTGGATCGTGATCCTGGTCTGCCCCGTGTCTGCCAGTAGAGATCCTCCC
ATAGCTCTGCTGTTCCGTGGATCTTGTCATATTCAGCGATGTCTTCGACGATCCAACATTCGAAGGCACTTCTTCcccttgttcttcttttaCCTTGACA
TTTTCTTGGGACTCACGGTGATATCC