Description :
From Genome Similarity Track
Location :
Scaffold_235:23490- 25626
Sequence
2136 bases(100 bases per row)
AACAGGACCAGCGGGCTGACGACAGGCACGCACGTATTTCGTCCACTGGTGAAATCGGAGTTGCAGGATCGCCAGTACCTGCTTCCTCTCACGCTGCAAC
CGCTTCTTCTCGGCAAGTTCTCTTGCCAACTGCTTCTGTCGTTCTGCCTCGAGTGCGGCCTCGCGTTGTTGTCGAGCCAATTCTTCTGCCATTTGTCGCT
GACGAACCAGCTCCAACTCTGCCCTTCGCCGTGCTTCTTCTCGTCGCATAACCTCTTGGCGCCGTCGTTCTTCTTCAGCCTCTCTTGCACGTATCTCTGC
TTGCCGACGTCGCTCAATCTCCCGTTCCCGCTCGATGCGCGCAGCTTCTTCCATTCGCTTGCGCTGCTCCTCTGCCTCTTGCTGCATTTTGAGCATACGC
TGCGCTTTCTCTTCACGCAACTGTTTCTCGAGTTCTTCTTGCTCTCGAAGTCGACGGAGTTCAGCTTCCTTCTCCGCTTTTTGTCGAGCTTCGTTGTCAG
CAACCTCCTTCTTCTCGCGCTCAATCTGCAGCCGCTTTTCCTTTTCTTGCTGCAGTTCGCGGATTCGCTGCATTGCTTCCTGCTGTTTCTGCTGCAATGC
TGCTTTTCGGATCGCAATCTCATCAAGCTCGTGCGCCTGCTCATCTGCCGCCGGTGCAGTACTCCATGGGTCTACACCATTCACCATCGCAGGAGCTTTC
GGAGTACGGACTGGCTGTATATCCTTTTCTTGTACGAAAGGGAGATCTGCGGCGAAATTGACAAAGTACGAGTACGGGTCTTCGTACGGTGTCCGCCTTG
GATAGAGCCTCGCTCGCTCCTTCTCCTCCGATTCATGGATCAAGTCGCTCAAAGCTGGATACTCTTCGTACTCAGTCACTCCTCGGCAAACATCGCGACG
AAGATAGTTCCTACAGTGCATTTTGTCCCAAGCGCCTCGGTTAACCAACAGTGGTGATTCAATCGTCGTTCCTTTTGAACGCACCCTTGCTTAGCCCCAA
TGTAAAACCACGAGGCGCGAGTCTCCAGCGGTGTCTTGTTCCGACGGAGTTGGATATCTGTGTGCGAGAAACTATGAGTAACGAAGTTCATGCACAATCA
TGAAGGCGCCTTTACCTGATTCAAAGTCCTCGCCACCGAAATGAACCATTGGTTGGTCATCGACAGTCACAACCTTCAACCCATGCTGACGACAAACCGA
TTCAGTGTGCTCCACATCATCGAAGCACAAGAGCTCAGCCAGGTCGGTGAGCGATATCCGCTGAGTGCGATACGCTCGGTTCATCCGCTGCAGAGCCACC
GACCGCATATTCGTCAGATACCTGAACATAAGGCACGCTTGCAGATACGTTGCTTGGCGCAAGAGCGAGAAGAACTGGTGGTAGTCTCCCGTTTGCCGTG
CGACGAACACCTTCATCGCGAACTCCACGTGAGGACTCTCGAAAATCATCTTTGGCAGTCCCTTGACGAACTTCAGCACGTCCAACCCTCGACCATTGTC
CAGAGTGCAGAGGATAAAGTACGCTCTGCATTCCGCTTCAAATGGGCTCAAGTATCGCGGATCCCCCAGCTTTCGGCTCTCGTCGTACAGTTCATTCAAC
GACTTCAGCGTCTGTCCGAGCTGCTCCATGTTCTGCTGAGCTACGAAGCTTGACACCTCGCACAGTTCGTGCTCGCTCAGAACATGATACCGAGCGATGC
GCTCGTGCACATCAAGAGCGATAGGATGCACACGACCCCCAGCGCCGCGGTAATTCTGCAGAACGAAATCCTTGCGAATCATCCGGAAGCGATCCCAGCA
GAAATTGTACAGCTCAATCAACTCTGGAGTCCGCGGAGGATTAAAGCGAGGATCGTCTCCATCTTGCTCGAGATCCATGATGTGCTTCTCAATGTACAGC
TGCGTTCGTCTCAGAACGCCTGGAGGTCGTATTTCATCCGGAATATCCAGCTTGTGGTCGGCGGAGCTGCGCTGGAAGCGCTTGATGATCATATCCCGCT
CAGATCCCGGTCGGTCTGGGAAGCACTTTTCAAACACACTGAGCTCATCGATGCGAATGTGAAGCTCACGTTCAGCGGGGCTGCACATGTCGACGCAGAG
TCCATCAAGACTCGTGGCCGAGGACAGTTCGGCTTT