Description :
From Genome Similarity Track
Location :
Scaffold_967:2348- 3668
Transcript NameFunction/comments
Phypl_g11849hypothetical protein

Sequence
1320 bases(100 bases per row)
CATCTTCGAGCAGTATTTTATTGCCTCACGGCTGTAATCGGCCGCAGCCACACGACCGCGTCATCGACCTAGTGTGGCATAAACAATGATACACCCATTA
TCGCTGTGGCAGCCAGTCACTTCGCCATACAAAAGGTAAGACACATGCACTCCATCCTGGTTTCCGATTCACTATACCAAAATCAACAGAAATGCGCACA
AGTTTCAATGACTCGGAagacaagctgctggtgcagatCGCCTTTCAATTCGAGATAGAGGGCCTGCGCATCACCTGGGACTATGTGGTCCGTCTGATGA
AGACCAAGCGCGTTCCGCGAgagctccgtctccagcttgCCAACTTCAAGAGGACGTACGGGAAGTCGATTACCGGCTTCCCGCCTTGGTTTTTAGTGGA
CTGACTTCGAGGCGGCTTCTAAGCGCGCCAAGGCTACTGCCGCCACCACCCCGCGTTTTTCCTGCGGCTAGTAACGCTAACCCGTTTGACCCCACCAATC
TCGGTTGCACGTCCAAGCCCATAGAACgggcgagcgagcgcgaggtggGCAGAGCGGCCGCAGAGAACATCCAGCAATCGTCGTCTGCACAGCAGGACGA
TGACACCGTTGGCGACGTCAGTGGTGCTGCCGGCcaggcagccgccgccgatcGTCGAGGGCAAGGTGCCGGGCAAGGCGACGATGACCAGGGAGCTGCA
AGCGcgccaagagcagcaggtaTGTCTTGCTTTGTGACGCAGGCTGTGGCAATGCTGTGACTGATGTTCTAACTAATCGTGGGTTTTTGCTTGTGATGAA
GGAACTGGAAACTACAGCTAGGGCACAGCCAACCACGCAGTCACTGCCGGGCGCTAGCGTGAGGGCGAGGTGTGGACGGTGGACACGGAGGTGCGAGCGG
TGAACGCGGATGACATGCAGCCCGGCGAGTTGCAAGTGCCATcagcgcagcaggtgcggcTTGCAGGTTTTGATGCTAACAGTGAAGTTGCATCTAATCT
TGCGTTTGTTGATCGTGTAGGTGCAGTTGTACGGCACTCTAGAGTCAACCCATGGCAAGCGGTGGAAGGTGTAGCTTCCAGTTTTGAAGGTATTAGCGCG
AACGATGTTCGCCAGCAAGCCGGCAATACGTATGTTAATGCTGGTGAAGTGTTACCGTCGGGCGTCTCGAAGATACTGGAAGCCGTTGGTCTACTCGGAG
AAGCGGGTGTTTTCCTCGACGTCGGAGCCGGCGTGGGAAACATTCTCGTCCAAGTTGCGCTTACGACAGACGTGAGAACGTGCATTGGCGTCGAGCTTCG
AATGGATCTGGTCGCACTTG