Description :
From Genome Similarity Track
Location :
Scaffold_24:234767- 237452
Sequence
2685 bases(100 bases per row)
TACGGTTTAATCGATCCAACGTAAAACACTGGATGTTTGCGCAGATTGCACGGAAGGTTTAGCGTATAGGCAAGGACTTTCTTAGCTACGACTGTGAACG
GTCTAACGAAGCGCGGAAGCAACTTTGTCTTGAAGACGGCGGGCACTGCATGTGTATGTAGGTTTTTAAGCATTTAATAAGACTTGGTCTCCAACTTTAT
AAGAATCAATACATCTTCTGCCTTTAGCATCAGCTTGTTCTTTTGTTTGTCTTGGCTATCAGTAATTGCATCACTCACATGTCGTAAACACTTAAGCAAG
TCGCGAGAAACTGGCTCATGTGTAGCAGAATATTGATAGGTCTGATATCAGCAAGCCTGGCGGCAACCTCTTCCCCATCAAGCTCATAGACACACAGTGG
TAGCGTTAATGGGACGCGCGGGTGTGTGAGGCTATTTACGTAGAAAGGAGTAAATCCGGAAGAGGCGAACACCGTTATTATACGAGAATTCACCTACAGA
GAGCATCGTTCTCGGAGGCTTATGCGAATCAGCATAAACAATGCGAAGAACATCGAATACGACGCGATTAACTCGCTCAGTTTGACCATTGGTCTGCGGG
TGATCTGCGGTAGACATTCTCAACCGTGTGCCAAGTACCCTAAATATGAAAGCCCAAAACTTGCCAGTGAATCAAGGACCCCTATCAGAGATGATTGCCA
CCGGAAATCCATGCTAACGAATCACACATTCGATAAGCTGCATAGCTTTACCTTTACCATCGATGGGGTCTGACACAGCCTATAAGATGAGCCATTTTGC
TTAAATCACCAACAAAGACCACAATGCAGTTATTGCCGTCACCGTTTATGGGAAGACCGAGCAAAAAGAAGTATTGATGAACTTCCAACACCAAATGGGT
ACAGGTAAACTAACGAGCGACGCCGCTGAGTGTGCCGAGGTTTTGACCAGTTGAAACGTTTCGTAGGTGCACATGAGTGACCATCCATTTATACCACCAG
TAGCGCTGAATCGAAGAGCCGTAAGTCTTTTCCCGTCCCAAATGTCCAATGAGAGCAGTATCATGTGCATCAAAGGGGATTCGGTTATAAAACTATCATC
GTGAGGCACGACGACGCGAGTATAATTCGTTACATCCGTGCGATAGCACAAAAAGCCACGTTCTATGGAATATCGATATAGACTGCACCTAACCGTGCCG
ACAAATGACTGTCCGATTCTTTGTACGCGTCGCTTCCAAGAGCATAGAGTAGTCCTCACATCGAGGATCTTGTGCATATGCCACACGGATCAAGTTCTCA
ACAGGAGACGACAAGGTCTTCAAATGAGCAAGCTCATAGTCAGATTGGAGAGACAGCGCATCCGCTAGCACTTTCTTATTGCCTGATTTACACTTCACCT
CGAAGTTATATTCCGAATAGAAGAAAATCCAATGAGCCGTTCTTAGAGCGTGGTGAAGCGACTGTGTCGCCGTGCGTAGTGACGCATGATCCGTATAGAC
AACGAATGGCTTGAAGTCAAGTATATGGACTCTAAATTCGATGAGAGCATACTTTAAGGCAATTAACCCCTTGTCATGAACTGGATAATTCTTTTCAGCA
GCTTTCAGCTGACGATATTCAAATGCGACAACACGCTCGTGTCCTATCGAATATGTTTGCAACAGGGCGCTACCTGTGGCGAAGTCAGATAAGTCACAGG
CGACACTAAACAAATGCTCCGGATTAGGTAACGTTAAAATGGGAGCATGTAGAGTACTATCCTTTATGATCGAAACGCGTTTGAATGTATGCTGTCCCAG
AATCACTCTGTGTTCTTCTCAAAGGAGATTGGTTAAAGTCCTAGCCATACCAGCGTAGCTTTTGTTTTACTTATATAAGTAATTGGCGAGGCCAAGCCAC
TTACGCAAGTCCTTTGATTCTTAGTAATCGGCCACTCAACTATAGCTTTGACCTTACCGTAATCCGTTCTGAGGCCGCGCTCTCCCGATGAAACATCTAG
AAAAGGAATATCCTCTACACCGAAGATGCATTTATATAGACGCGTTGACATACAACTTATTCGTGCTCATGCACCCAACTACCCCTCGCAGATGGTCCAT
GTGATTGTCAACAGCCAACCGACCCTGTTCTGACGACTACAAAAATGTCATAAATGTATGCTTGTGCATAACCCTGATGAGGATAGAAAAGCTGTGTCAA
TGGACGATCAAACGTAGCCGGCGAGTTAGACAGCCTTTAGGACATAACCAGCCATTCTCGTAGCATACCACTCGGGGTGCTCACTGCTGTCAGCGAAATA
TCACTCGCTCCCATGATCAATTATAGTATCCATCGACCAAGTCGAGTGCGCTATACATAGTACAACCAACCATGTTGTGTTGAAGAACATCCTTTAGAGG
AATGGGTGTCTGCGCCGGAATAGTAGCCGCATTAAGCTTGTTATAAGCATGCACAATACGCCACTTGCCGTTCGGCTTTTTGACACAAAATGTCGGTGTC
GAATGTGAAGATTTAACCCTCACGTACCATTCCTGCCTCGTGCTTAGCACGGAAGAAGTCATCAATGACATCACACTGTTTCTTAGGAAAGGGCCACTGT
CGTGTGACACGATATTTAGTTCCAGGAGCTAAATCAATTTCATGACGAACACCTCTATCTGGAGATAGAACAGAAGGTGTATCGT