Description :
From Genome Similarity Track
Location :
Scaffold_62:23476- 25209
Transcript NameFunction/comments
Pytve_DAOMBR484maker-pve_contig_62-fgenesh-gene-0.9AAA ATPase domain-containing protein

Sequence
1733 bases(100 bases per row)
CTGGCCCTCGCGCTGCACATCCTGCTCGTAGTTGGGGTTCACGCGCACATGAACCGTCTGGTTGCGCGACACCGACCCTTCCAGCAGCTTGACGGCCATG
GGATTCAGAACCTGCTGCTGGATCACACGCTTCAACGGGCGAGCGCCGTACAGAGGACTGTACCCCTCGTCTGCCAGCCAGTCCTCGGCGTCCTTGTCCA
CCTCCATCTTGATGTCGTTCTCCTCCAGCATCTTGTCCACAACTCGCAGCTGCAAGTCGACGATGGAGCGAATGTCTTCCCGGCTAAGACGATTGAAGAG
CACCAGCTCGTCGATTCGGTTGAGGAACTCCGGCGAGTAGTGCGAGCGCACCACACTTAGCACCTCCGACTCGACCGACGAGCTGGGCAAACCTTCGGGT
AGCGAGGACAGGATGTCTGAGCCCAAGTTGCTCGTCAGGATGATCACCGTGTTACGGAAGTCAACCAGCCGCCCTTGCGAATCGGTCAGCCGACCCTCGT
CGAGGACTTGCAACAGAATATTGGACACATCTCGGTGAGCCTTCTCAAACTCGTCGAACAGGACAACTTGGTACGGGCGACGGCGAACAGCTTCAGTCAA
GGTGCCGCCCTCTTCGTACCCGATATAACCGGGCGGCGCACCAACCAGACGACTCACACTGAACTTCTCCATGTACTCGGACATGTCAATCCTCGTCAGG
GCTTGAGGAGTTTGGAACAGGAACTCGGACAGTCCCTTGGTCAGCTCCGTCTTGCCAACACCGGTCGGTCCCAAGAACATGAACACACCGAGCGGTCGGT
TGTGGGCATGCAAGCCTGCTCGAGCGAGGCGAACACAGTTGGCGACGGCCGTCACGGCCTGTTGCTGGCCGATCACATACTGGTTCAGCTGATCCTCCAT
CTTCAGCAGACGCTGCTTCTCGCCTTCCATCAGTGTGGACGCCGGAATGCCTGTCGACTGCGAGACGACTTCGGCAACGTGGTCCGCCGTCACGGCACCA
CCCAATACCGAGTGTGTCGCTCGCCTCGAGTCGGAAGCGGAAGCATTCGCCAGCTCCTCCTTCTTCTCTTCGTCTTCCACTTCCTTCTCCAGCTTCGGGA
TGATCGAGTGCAGAAGCTCGCCTGCTCGCGCGTAATTGTAGTTGTTCTGCGCAGTGACCAACTCGCGCCGTGCCTCTTCCAGCGTGCGTTTGTTTTCGTT
GATCCCAGCAAGACGGTCTTTCTCGATGTTCCACTCGTCAGTCAGCTTCTTGAGCTCTTCGTTGGCAGTGGCGACCTCTTGCTCCAGCAGCTGCAGCCGC
TTCTTGGAAGCCGCGTCCGTCTCCTTGCGGAGCGCTTCGATCTCAATCCGGCGGCGAATAATCTCTCGGTCGAGCTTGTCAATCGGTTCGGGCTTGCTCT
CCTGCTGCAAGCGAAGACGCGACGCCGCTTCATCCATCAAATCGATCGCCTTGTCGGGCATCTTGCGCTCGGTCAAGTACCGATCCGCCAGCATCGCCGC
CGAGACCAGCGCGTTATCCGAGATGCGCACGCCGTGATGCACTTCGTACTTCTCCTTGAGACCGCGGAGGATGGTGATGGTGTCTTCCACGCTCGGCTCC
GGGACGAGCACGGGTTGGAAGCGCCGCGCGAGCGCCGCGTCCTTCTCGATGTACTTGCGGTACTCGTCCAGCGTGGTGGCTCCCATGCAGTGCAGCGTCC
CTCGCGCGAGCGCTGGCTTGAGCATGTTGGCCG