Description :
From Genome Similarity Track
Location :
Scaffold_11:23475- 24735
Sequence
1260 bases(100 bases per row)
TCCGCCCCGACGACCGCCGCCGCCGCCGCGTTCGGCGCGCTCTCGCCGCTGCAGTCGCCGCTCAAGACGCCGGCGCCGCACTCCCCGGACTCGGTGCGCC
AGCTGCCGCTCGCGCTCGGCCTGCAGACGGCGGCCTTCGAGCAGTTCGGCTTCACGTGGCACTGGATCGTCGAGGTGGCGGCCCACTTCGCGCTGCAGCG
ACAGACCGCGCACTTCGCCAACCAGTACGCGCAGGTGCTGCTGCGCCGCCGCGCGGCCGCCTCGCAGCAGGGCGGCAGCTACGCGACAGGCTACGGCGAC
GACGTGCGCCACACGCAGCGCCAGCTCCGCGTGCTGGGGCTGGCCTGCGTCTTCATGGCGGCCAAGATCGAAGAGGTCCACCCGCCCAAGGCGGCCGAGC
TGGTCGCCTTCTTGGCCGAGAGGGGCGGCACCCAACTGGCGGCGGAGGATCTCGCGCGTCTTGAAGTGGATTATGTTGTGGTAGGTACTAGAGCAGCAGT
ACTCTAGGGAGGGGGCAGCAGGAGTGAGCGAGCACCTTGCTTGCTGCACCTGCTGGTAGATGGCAGACAGATGGGTGGCGATGGATTTTTAACGCTGTTC
TTATGTGGCTGGTGATCTACAGGAGCTGCAGTGGAACCTGCACCCGACGACGCCCTACGCGTGGCTGCTCTTCATGGTGGCGGGCGGCTCGGCCGACCAG
CGCCCGCTGGACACGATGGGCGACTTTGTCAACCCGGCGCGCAACCCGTCCGGCACCAAGGAGCTGTTCGTGAACGCCATCCGCCTGGTGGACATCGCGC
TGCTCGACTACCAGGCCATCGAGTACTGGCCCAGTGTGCTGGCGGGCGCCGCGCTGCTGATCGTGGACTCGGCGCTCGACTTTATGTTCGTGGCGCAGTT
CCTGCAGCTTGACCCCAACGTGCTCTGGGAGTGCAAGTCGTGGCTCTACACCATGGCTTACGGGGTGTGCGACCTGGAGGCCGCCAGCACGCAGGCGAAG
GACCGCTGGGCCAAGGTGCCGGCGGAGGAGCTGCTGTTTATTCAGTCCCAGGTCGTGGTGCCCAGCCACCTCGCCTGCGGGCTTCTGCGCCCGGATCATG
TCGTGGATCTATACTCCGCTGGCATCAACACATCGTTCGGAAAGAGCTACGGCTTCGAGACGTGCCCGTCGCCGTGCTCGCCGAGCGACAGCTACGCCGT
CGTGGCGCCTCCTGTTCCTACGTGCATGTGCAAGGGCAACTACCACACGTGCGGAGGAGA