Description :
From Genome Similarity Track
Location :
Scaffold_4:234739- 235780
Transcript NameFunction/comments
Pytul_DAOMBR144PYU1_G002087Protein of unknown function
Pytul_DAOMBR144PYU1_G002086Protein of unknown function

Sequence
1041 bases(100 bases per row)
TGCCCATGAAGGTCGTCCAAGCTGATTTGCTGGCGCAATCTCTTGTGGCGCCAGAATCGACCCTGGCTGAGACGTCTGCTCTCGACCATCCCATTGCCAA
TAGCAACAAACCTAGTCTGGCTCTGGTTATAGATCGCTCCGTTGGCATCGCGGAGAGGCTTCCCAGTATGCACAATATGGCGTCGTATAGATCTTCCCCT
CAGCAGTATTTCTCTGCACAAATTCGCCACAAACGCAATAAACGCCCGAAATAGTAGTCTACAATCACGCGATCACTAGCAATGTTTTTGTTTTTGGCGC
TCGACGTTCGCCAGGAGATTCGTGCTTTCTTCGGGGTGAATACAACAAATGTCGTCCGCCAGCCCCTGGTACCCCTTGTCTGCAAGATCCGCCCACACGT
CGGGGTACTGGGACTGCATCAGATCCGCATCTTCCAGGGACTGGTCGCTCTCGGACTTAGCCCGCAGGCGGCGATGAAAATCCATGTTACATGGCGATGT
CGGGCGTGTTGCCTCGCGCGTGGACGGAGCAGTTGATGGCAGCTTCGCGAGAGCTCACGGAGACTTCGACCTTGAAACCGTACAGATTGTGTTACGCGCT
GTAAAACGGCATGGCCTCGAGCCGCATTCTGGGTGGCCGATTTGCGTGTTGGAAGGTCGTGTCCATGGCGTAAAGAGCGCATCAGAAGTGAAGGAGCATG
CATGGCGCACCCCGATGCGACTAAGCTTTTCATCATTTCCTTGCAGGCCGCTTTGTCTCCGAGGACCTCATAGAGCTTCGACGCAATGACGTGAATAAAA
CCACTCATTGTCTTGATAAATGTCGGCGACTTGACACTGAAAATGCGCGAGAGCATTTCCCACGTACCGTCGCACTTCGTCGTGACGAAAAGCACGAAAA
ACACGTCTTCGCCCGAGAACTGGGAGCGCTTGCCGCGGCCAACGTTCCAGCAGCGAGCCACATAGTCCTTCACCAGAGACCAAAGCGCAGCAAACTCACG
CGACGAGAAATTTGTGAGGCGCTGGATGACGTCTGCTCTGC