Description :
From Genome Similarity Track
Location :
Scaffold_46:234715- 235842
Transcript NameFunction/comments
g2009.t1hypothetical protein

Sequence
1127 bases(100 bases per row)
TGAAGACCGTTCTGTCTGCAAATCTCGCCGCGCCAATACACACAGTATTAGTCAGACGCTTCACGCGATCCGATCAAAGGTGTCTTTGGGACGACAACGT
TGTACTGTACACAAATGTCCGAAATCTAGTCAGACCAATATCCGGACGGTCGAAAGCTGCAGTCAAAAAGCGGTGCACAGCATCACCAGAATATCGCCCT
GACCAGGTTAACCATGGGTTGTGGTAGCTGCCAAGAATCTCACTAAGGATGTACTCCACACGACGTGCTGGAGTCTGCCACACAATAGGTGCTGGCGCAG
ACGCCAACGTTCTCGCTGGACTATCTCGACACGCGCGACTTGTTCGAGCACACTGCCTCGCTGGTTCACACGAACACGTACTTCGATGGTGAAGATCCTG
CGTTCGTGAACGAAAGCAACGGTGTCATCGCTTGACGGAAATTGCCGCCCAACGACCCGGAGTGCACTTGCAGCACGACTCAGCTCGAAACAACCAACAT
CAAGGCCTCGATCGGCTTTGGTGGCAATGCGAACAAATCGGTGAGTGTGGACGTTGCCCGTACAATCGTGTTGGATATTGAAAGAGCACATTTCAGACGA
ATTCGCACGGTGGCCATCGCCATGTACGACGTCGCGGCCTGCTTGATGACGCCTTGTAGATTGCCAGCCCCATCCGCGACACGCTTGACATATAAACGCG
GTGCACTGGAGGCAAATCTCGCACCGAGTGGACAGCGAACAAGAGTCGATGCTGTCCCCCACGCCAGCCGAGCCACAATTTCAATTTCCCACGTGAGAGT
CTCAGACCGAGGCGCTACGTGCGCAGTCTGCTCGAGGTAACAGGGCGAAAGTCCCTTCCACCTCCCGAATTGCTCCTTGCAGTGCAAGGCTTGCACGCGT
GGCACTCGACCAGGTGCGCAGATGACTTGACGTGCTGGAGCTTTGCAGTGCGTCAACTTGACATTCGTAGCGTGGGATTATCTGGTTGCGCAGTGATCGA
CCTGTGCACCACCTCAAACCTATTTACGGTCATAATCACCACTGTGCTTATCCGATTCAATATCTATTTAAATAGAACTTCCCTAAAGACTATTCCTTTG
CTACCCCCTAGATAGTTGAAAATAGGT