Description :
From Genome Similarity Track
Location :
Scaffold_123:23465- 24601
Transcript NameFunction/comments
Pytar_ATCC12531maker-par_contig_123-fgenesh-gene-0.6Protein OSCP1

Sequence
1136 bases(100 bases per row)
CAGCGCACCATCGTCGTCAAAGTACCGGACAGTCCCGGGCACGCGTCCGCCGGACGCTGTGGGCCCGTCGTACTTAATGGCGAGCGTGCCGTCCATGCCC
TGGATGCCGTTCTGCAGAAAGAGCGAGACCTTGATGCGTGTGTCCTGGAAGAAGCGGCCCAAGAATTGCTTGAGAAGGAACCACTCGGCCGCGCCGAGCG
CACCAAAGGTCTGCGACGTGAGCAGGATGGTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCGTCCAGCAGGCGCGTGACGTCGGCGCTG
TTGATGAGTGCCTTGGTGCTGGCGAGGTGGTTCATGGTGACTTGCAGGAGCTCGTCGGCTGAGGCGCACGAGAGCAACTGGAATTTAAAGCCCATGCGCA
TGAGATCGTAGAGCTTGTCCATGCTCGTGGCGTTGAGCCGCATGATGGATGAGTGCGCGAGCCGGTCAAAGATCTGGCGCGTCGCGGCGTTCGTGTACAT
GTGGTGGGGCTTGAAGAGCTCTTGCATGAAGGTGGCATTGTGCATGGTCTGCAAAATGTCTTCGAGCACCTTGGAGCTCTTGTCGCGCGGGATGCTCTGC
GCCTTGAGCCGCTGGTCCAGCACGTACACCATCTCGGCGCCCATGTTGATGACCAGCATGGGCATCGCCAGCATCGCGCCGTGGGCCATGGTGGCGGCTC
AGGAGGGAAATGGCGATCTTGGCGGGTTGCGTCCTTTCGTGCTCCAAAGAGTCGCTACCGGTATAAAACCGGTTTGAAACCGGTTGGATCTTTGCCCGGG
CACTATACGTATATCCGGATACCATTGTTGATCCGGATAAAGAGGTATGGACCGACATGGCTACAGATCCATAATGGTCGCATATCCAGAAAATGGAGCT
GGAGGAGAGAAGATCAATAGCACTATTCTACAATGCGGTCATGCCGAATCCAAAAGCCGCAGCAAGTCACTCTCTTCGTCGTTGGCGTCGCTGGTGACGC
CTTTCGATTGTGCCAGCGTCCCACTCGTCTCGCAGCGCGTCCATTTCCTTGCAGTCGCGTTGCGCGTCGATCCAAAGCGTGGGTACATTCTCATCCTCTT
TAACTTCCTTGGCGTCATCAAACAGTGTCCACTTCC