Description :
From Genome Similarity Track
Location :
Scaffold_457:23460- 27497
Sequence
4037 bases(100 bases per row)
TCTCAACTTTCAAGATCCCGTCACAGGAGGCGGCAAGTACGACGCAAAGGAACTACAAAGGCAAGGGAACACACCCGTAAGGCAACCCTACGGCCAGATC
CACGATCTAGGCCCCGGATCCATAAGCTCGAATATTCGCTTAGGATTCGGAACAATCCACGGACGCAGAGTGAAGATTTTCCACTGCTGCTCCACCCCAT
CCCCACGCCTCGCCAAGACACTCAAGCTTCACCACTTGAACTCTTCGATAGGTACCGAGAGAGCAAGATCCCGCCCTACCGACGGGTACACAAGGTGAGG
AAAGTTCAGCAGAACACGGATCATCGGGGGACCCCCTCCGTTAGTCGGTGTCTGGGCGCAGTTGGTAAGTTGGATCTGGCAATCTCGCAGATTTTGCTGA
TCCCGCTACACCACAATGGTGCGCGTGCCCGGATCTTTGGGGACTCGGGATTTCACCGTGAGTCCCAAGAAGATGCTCAAGTGAAGATTGAGCCAGCGGA
AGAGGCGTCGTCGGAAGTCGGATCGACGAAGACGCTGCTGAATGAAATAAGATCCGCGGATCGATGGAGTTTTGGGAGGAACTCTGTCGACGGAAGAGAG
GTGGATCCGGATCCGGATCTAGAAGAGAAACCTCTCTATCCTCCCCAGGTCCCCTCGGGGACCCCTGCGGATCTTGACGTAAGTCAAGATCCGCTAACAA
AACAAGGGAAAGTGAAGGCGAAACGGTATGCATTTGCAGATTCACCGATTAAGCCAACACCGTACCTAAACCCAAGCCCGCTAGTCGAAGAAACAAGAAA
GAAGACGAAAACGAGTAAGACTACGCGGAAGAAGATGCAAGCTCCAGAGTCGGAAGAAGACCAAGCTGGATCCAGGTCAAGCTGGTCCGACAAGGATCTC
GAGTTTGTGTATCGCCACCAAGCTTTACGCGACTTCCTGCATCAAGATCCTGTCATGCAGATCCTGAATCCACGACAGATCGAAGATCCAAGGGAACCGG
TGAGAGCACCAACGAAAACGGCGAACAAGTTGGTGGCAGTCAAAGATCTATTACGTTTGCTTACGGAGTCAGGCATCGTAGCTGGTGTGTTCGACGCAGA
AGATATCTTCGAGCTAGACCTGGATCTCATAGTATCCGCGACGCGGGACCTCTTTGCCAGAGTTAAGTCCATCACCGGAGAAAGGTCGCGCACTATGGAT
CCAGTGTCGTCGCCAGAGGATCAGCCAAGCTGGCGTCCTCCAAATTCAGACATTCGCCGCCTGAGGAATGTAGTTCGAACCCGTCGCTCCGAACCACGCA
CGCATGTACTCTTTAGGACCTCTCGGGGCCATCTCATGTCTGGGAAGCGCCGGCGAGGATCCGAGGACAGGAAGCCCCTGTGAACGTGAAAGCTCGGGAT
CCAGTACGCCCTACGCGTGATTTGACACAATCCAGCCAGGATCGAGCCAGATCCGGCAAGAAAGCCAGTGGGGATTATCGTCAGATCAGGCTCGAGGTAA
TCGCCTCACGGATCCAGTCCCGCCAGTGGACCAGACGGCCACAGGCTCTTCCGACACTTCCGCGGGCACCCTGCAACGGCACTTTGAAGCTGCGATGAAT
CGCTTCCTGGCCGAACAGGGTATGAGAGCGCCCGTGCCACAAGTGCAAGTGCTCCATGAACATGGAGCACGGGACGTGGAGATGGAGTCAGTAGAGGGGG
ACAACTCCCATGATGAGTTCGACCCAGACGATCTGGATGGCCCATCCACTTCGGCAGCCGTGGTAGCAACGGCCACAGCCGGGGCAGGTGGATCGTCCAT
GATCCAGAGGGTACGGATCTCAGCTATATCGGACTTGAAGGAGTTCACGGGCAAGGATCAAGATGAGGACCGAGCGAGAACATGGATCAGCAAAGTCAAG
TCGGACCTCATGAGAGATCAAGCGTCGGATGCTGAGAAGTGTCTGACCTTTGCGGATCTGCTAGCGGGGCCAGCCAGGAACTGGTATCGGCAGCTGGGCA
GATCAACCAGGAACAAGTGGCCAGATTTGCTGCGCAGTTTCCAGACCCAGTACTGTGGATTAGGAGTGTCGGTGGCACGACAATACTACCATGCTCGCCG
CAGATCGGATGAATCCCCGTTGGAATATCTACATCGACTAAATGTGGCCGGTCTACGGGCCAAGTTGAAGATCAAGGATGGGGGATCCAAGGTACTGCGG
GAACACGTGGATCATTTCATCGAGACGGTGGGAGACGTGGATCTGGCCGACAGGCTGATCCTGTTACGATTTCCCGACGCAGACGAGCTTGAGGAAGTGC
TGCGGGCGGTGGATCGCGCGAAACACCGCCAGAAGAAAGCGGCGGTCGGATCCGGCAAGTATCGCCAAAAGGCTCCGACGCCTACGGCCCCAGCTCGACG
TGTCCACCAAGTCACGGCGCCCGACTCAGGAACTGAGTCAGACTCCGACCCTGAAGAGTAGCGTCGAGTCTGTCTCACTGCGTCCAACGATCGAGCGGCG
AAGACCGGAGACAACTCTCGACCGAGGGATACCGTACCCGGGGACCGTGGGATGTACAGATCCCGAGATCTCATGGACGGGGCAGCACAAGTCAGGTGTT
CACAGTGCGGATCCCGGAAGCACACTGAATCTGGATGCTGGAAACATCTGGTCTGTGAGAAGTGTGGCAAGAAAGGTCATCCCGGGGATCATTGCTTCTA
CGTGTGTCGCGGGTGTGGCGAGATTCACGACGTCGGCAAGTGCCCGATGGAAGAATTCTACAACCAGATCCGCCAATGGTTTGATCCAGCCAAGCACCGA
GGAATGTTGCCAGAAGTGGCCGAGAAGATGTTAAACTAGGACGCTCGCCGGGTTTGAATCCGGTACGAGCCGAGCGTTCTAGGTACTGCATTTATGCATT
TGTGAACAAGACATCGCTAGATCCAGGTAGCAGGACCCTAGATCCAGTCGATAATACACGTGATTTACATAAAGTGTCAGTTGCCAAGATCTCTAGTTTG
CGCCAAGTGGATGAGTTTGCCAGATCCGAAGTCTCTTCAACCCTGGATCTACATAGGGGAGGGGCACGTGGTTACTGGGAGAAGCGTCAACATGGTCGAT
GGTTTGAGCCTACCAAGGGTAAGGTCACTGCAGATCCACCTAAGGTCTGTCAGGTCACTGGATCCCGTGGATCTGAGGATGTTGGATCCATGGATCTGCT
AACCGGGGAGTCCCGTGGATACTGGAAGTACCATGCCCCAGGAAAGTGGTTCAGACAAGCCAAGGTAGGGGGCAAAATCAACAATGAAAAAGGCAATCCT
ACTCCTAGATAGTGGTGCCGAGGTGTCTATACTAGATACCGCCTTTGCTCGTAAGGTTGGGTGCCAAGTGGATGGGAGTCGGATCCAAGACTGTGTTGGG
ATTAATGAAGGCGTGTACCGTACGAATGGGAGAACGCGGATCAAGATCACGCTGGCAGGTTGTTTGGTGTATTGGTTTGACATCTGGGTTGGAGATCTCG
CTGGTCAAGACGCCATCCTCGGGATGGATTTCATGGTACCGGCCGGAGTGAGGTTGGATCTAGCGGATGGGACACTTTGTTTCCCTGACGAGATGCGGAT
CCAGCTCAGCGGACGGCGGAGCAAAGATGAGGACCATAAGGGTGGATAAGACAACCTGGATCGAGCCCGGGGAAACCTGGGAGCTGCCAGACCGGTTAAA
GTGGGTGGAATATGAGAAACTGTGGGTCACTCGGGGCGAGAAATGGGTACCTACCGTAATCCAGGGGCCAGGTCGATCACAATACCTCCAGGTCACGAAC
GTCAGCGATAAGAGACTATTACTGGACCATTATGAGGCGATCGGGCGATGGTTAGCGAAGGACGGTATCCCTAGGCGACCTGGATATGTGTCAGTGGGAT
CCCGCCGCTACAAAGAATGGCAGAATCTGGTGTACGAGGCGACTACCGAGATCGAATCGCTCGGAGAAGTGGAGCCCTCGGCGGAGCCAACTGGCCCCTT
GGTGGATCGGCCTTCATATCCAACTCCGCGAAAGATC