Description :
From Genome Similarity Track
Location :
scaffold_116:23460- 24647
Transcript NameFunction/comments
Pl_109408hypothetical protein PHYSODRAFT_347972
Pl_109409hypothetical protein PHYSODRAFT_347974

Sequence
1187 bases(100 bases per row)
GGGGCATGCCACACCCGATCAACGAAGTGTTGATATCGTCCTTCCGTCAGATCATGATTGCGCGCCACCAATTTATACAGAATGTTTTATTCCATTCGAT
TCGTTCATGAAAGAGTGGGTAGGCTCTGTTCCAACGAGGACTTTAGTTATAAATGCATGGTACTAGTTCGAAGGTTCACGTCTAGGACTCATTAATTTTG
TAATACTGAAGTAATAACATTGCGAGATCAACCTGAACAATGTGTTGCGAAGTAGAATTCGGGTAAATTATGTTGTCGTAGTCTTCTTCTCAAGTAAGAA
TTGATCCATCGTTTCGTTTTCAAGAGCTTGAACCCGAGACATTAGCATGGCTTGATAGAGTGCGGTAAGAGCCTTGAGGGCTGCTTCTTTTTCACAAACG
ACCGGACGCATTATAATACAACCCACACAAACGCTAACGTTGTTGTTTTCCATCGAGTGAATAACCCCCCATCCCTGCTCGTACGTCTGGACATTTTGCA
GTTTTTCTTCATGATTCTGCCAGTCGACAAGCATATTCCATACTTGTACAATGCGATCTTCCTCAACAAATTGCTTTATCAACACGCGCATGGTGCATAC
GTAGTTGCCCACCGCACATTCGTACTTTTGAGCAGCAACCCGTGACGCCGAGCCAAGCGAAAGTTCCTAGTAACATATTGAGGCAAAAACATGAGAAACC
TTGTCAACGAGACCCCAATGACATTATACATGTACGTACGAGATTCTCCATGGCTTGATTTATCCCACACGCGTCAACATATCGCCAGAACGCCTTCTCA
AGGGTGCTACTGTTGAAAGGTTTGATCATTCGTGAACGAAATTTCAGTATATCACCATCACTTTCTTTCGGATACACGGAATTCGCGCGACAAACGTAAG
CGTCAGCAATTTCTGACGTAGCTCCTTCAAGTCCCACACGTCGAAGCACACGGCCCATGTCGAGGTATTGATCATCAACTCTTTCGGCCATTTTGCTAAA
CACCAAGAGATCATGGATTGGGTCGAATGGAAGGGCCCCCATGGTCATAACCAGTGATCGAGGTACCATCAGCTGCAACAATTCGTCGGTTTGTCGTATC
AAATTCTGCTCTGAAGCGTGCATTTCTTCGAGAGTCTCACGTAACAATGTCTTCATTTCTAGATTCTGGATGTGTCTGTGGAATGTA