Description :
From Genome Similarity Track
Location :
Scaffold_21:2346- 4691
Transcript NameFunction/comments
Phypl_g897hypothetical protein

Sequence
2345 bases(100 bases per row)
TACTACACGACGAGCTTCTCAAACAAACTCAACTCACATTCAGCATTGCAGTAAGCTGCAAACTCCCACCCTGACTCGATCGAGGAacccacagcagcaa
tgaCCCCCCTCCTGTACCTGGGAGACCCAGGAAACCCGGACGCCATCGATCCAGGTACAACGTTTTGCCTCCCAACGTCATGACATCCGATCTCCACGTC
ACAGTCTTTCCCGCTGGcacgtccacctcgtcgatcttgtGGCCACCGGACTTGATATTCACAGTCACGTCCTCCGTATCAGCGCTTTCGAACGTAATTT
TGACACTGTCGTCACCTTTCTTGGTCCAAAAGCCTTCGCTATTATTGAAAGCGCGTTGGACGACTGACATCCCCAAAGCTTTCACCGCATCGCCGTCATC
GATTTCCCCAATATACTCTGTTGGTCCGCAAATCGGTTGAAAGTACTCGGAAATCGCTCCCGTGGCAGACCACGGGTCCCAAATAGCCCAGAAACTGAAT
GCCTTGTCCGCAATGTTGAATGCGTACTCCTCAGCTTTGAGATAGGACCCGTTATTACTTGTTCCCGATTTGATGAGATCATCTACGATCCCTCCGAACG
TTTTGCGAAGCGTGTCACGCGTGGCGAAGGCTGTCGTCTCGTCCGATTCCGCGATCAGGTCGCCCATACAATTATTTGTCGCCGTCGGGATATCGTTTAG
CACGAGGTTGGACTTGCTCACGGCTACTCGAATGTCGTCCTCAGACATCTCGGGGTTTTGCTTCCGAAATTCAGCAACAGTCATCCACGTATGGTCCAGC
ACTCGCTTCATATCGTAGCCACAGGTGGAATTGGACTTGAGCGCGGATTTCAGAGACTTGATGTCAGTCGAGCTCAGCGATTCAAGCGAGTCTCCCAGCG
TGGCGTTCTTCATAAAAGCTGTGAACTTTCCCCAACTGGATAGGATGGCTGCATCAttggccacgacctccttCAAGACGTACTCTGCGGTCATCAACAC
ACTGTCGACAAACTTGATCTCATCAGACGCAGATCTTCCGATACAGTAAGACACTGCAATGGGTATatcgacgacgatgttgTCTGTCTGATAgagcatc
gccagcagcttgtcctggGGGGTCTGCGGGTCGGTCACGTGAACATTCCGAACATACTTTGCCAGCGACTTGATCAATCCCATCGTGTATTTGGCGCACT
TGATAGCCACTCGGACAGCGCGTGCCAGCGTCGAGAGCTTGCCGAAGACGTCGTACGTTATGAGAGACAGAGTCGTTTGAGCCAAAGCGACCACCTTGGT
GACGACTTCGAGCGCACAGTCGTCATTCTGCCGGATGCACTCCATTCCACACTGTACGGGGAACGCGTACGGACACTGCGCCCAGCATGTCCCGAGCTTG
CTGTTGTATCCCACCGGACACGTCTTCGCGATGTGAGCTTCACGGTAACACGCGGTGGTTTTGGAGGTGTCGAGCGCAGAGCCCACCCAGTTAACGTACG
TGGACTCgatcgtgctggtggcaTTAAGCACGCCACCGAACGTTAGTGCCGCGCTCATGGCCTTGGAGAGTGCGTTCGACTTGGAAGATGCGCCGCTGAT
ACTGCCGGCGCCCTCGCCACTCTCACTTTGAGGTAAACTGTCATCAATGCTATCGGAGGAGTCGTCATTGCTATCGGAGGAGTCATCTAAGGCGCTGTCT
GACGGGTCAAAGGAGCGCTCAGCCTGTAGAACGCTGTCCACCGAATCGCTACTGTCCGTCGAACTGCGATCGTAACTATCCAAGGAGTCGAGAGCGTGAT
CGACGCTGCCCGATGGATTGAAACGAGGCACTGAGCCTAATAGTGTTGACCCTGACGCTGACGTTTTGCTGAACGCGGATGTCCTCGACGAAGCTGACAC
TGTATCTCCTCCACATATTGCTGCACAGACTACAAAGACGGCCAGTAACCTGCGTTTCATGCTGGGGTCTCCACAACACGGCAAAACGAAGAGTGAGGTA
GTCGACCGACCATCCTTCGCGCTGACCGTCTGACGGGACACAGGATACCACCATACAGTACTGTAAAACCCTGGCTTTTTGAGTCAAATGTTCATTCTAG
TCGCAGGGCTGATCATCGGAATGGGGGTAGACGGGTGTTTCTCGTCCCTTCATTGTTGAACACGGCTCAAGACTTTCCCGTGTTTAGCCATCTGGGCCAC
TCAAAATATCATTTGCTCTATCATTGGAGCCGTCTCCGCCACTCACTTGGCTGGAAGTTCGTGTGCGGGGGAATCTCCTGCCTGCGAGAGACGCCGCATC
CTGTGGCGTTGTGACTGTCGAGATACCGTACGAGGATATGCAGCC