Description :
From Genome Similarity Track
Location :
scaffold_151:2346- 3617
Sequence
1271 bases(100 bases per row)
AAGGTACAAGCTGTATTGATTGGGAATGGTCAAAAGATCACCAGGCAATATTTGCCGAAGTAAAGATGAGCTTGAGAGAAGCTTCTGTTCTTGCAGCTAC
AAACCATATAAAACTTTTCATGTGGTCTGCAATGCAAATGATTATATCATCGGTTGTGCGTTGATGCAATACGGTGATGAGGGTCGAGAGCGACTTGTTT
TGTATCTTTCGAGGCAACTTCGAACCGCGGAACGGAACTATCCAGTTCTTGACAAAGAACGtctagcaatgaagtatgtttTGGTTAGGTTTCGTGTGTA
CTTGCTTGGAGAGGAGCGCTTTGCAATCTATACAGTTCATGCCTCATTGCGTACGGCAGTCAAGACTCCTCATATATCGCAAAGACTGTTTCGATGgttt
tccttctttgcggggTACAACTTTGCTCTACACTACAAGCTAGGCAAGACAAACAACTTtgccgatgcgttgtcaagacGTCTGGACTATGATCCAAATC
CCAGGAGCGAAAACATGCTcgagtcatgtcgacaatgcgaaGATGTTCAGACGTTCAGAACGGAAACTACGACTACAGTACGCGAAGAAATTGTTGAAGG
GTACACGTCAGATGAGGGCTTGTTGAGATATTTTAACAACCCTTCCGACAATGCACCGCAAGGTCTTCCGTCTTGTACAAGATGGCGTGTTCTCCGTTTT
GAAGTACACAAGGGATTGTTGTACTTTGCGGTTGAACACGGGGATACAGCACGAGATGCTGTCCCAACTGACGAACGTTTTGCGTCATCTTCTCTTATAT
GAGCTCCATGACAGCCTTTTGGGTAGCCATCTCGGACGTGAGACTGTCCGGAATTTCTAATAGCCACAGATGTATGAGTGGGTGCGCAATTATTTGAGAA
CCTGTGAGATTTGCAGGAGAGTGAAACCATCGGGCTCCACTCAGGCCCCACTTCGTTGGTAGTGACAACCGACAGCTGGAAGTCTGTGCGTATGCTGGac
gttgtgtttggcctaccgAAGGATTCGGCGAGTaccacgggtgtggtggtcatttgagcaagatagctcatcttgcagcagtgctacacaccatcgacgg
tgtgggtacagcaacgctgtttgtcgatcgcgtCTTTGGACAGCATGGACTTTCGGAGTCAATTTGTTTCTGTTAGagccccgcgcttcactgggaaggt
ttggtctacaatcttcagcgTGCtaagcaccaagttgaccatGTCAactgcggaccatccgcagaccaatg