Description :
From Genome Similarity Track
Location :
Scaffold_12:234538- 239904
Sequence
5366 bases(100 bases per row)
ACGTCACTCTTATGCATAAACATTCACTTCTTCCTCCTAATCCACCCTGTGGATTCGTCTTCTCTTTCTTTCCGATGTGACCAACTCATATCAGCGATCC
TCCTCCTCCTGACCCACACCCTTCCTGTGGGTCCTTCTTCATCCTCCCATCGATATGACCAACTCACATCCATGGGTCCCCTCCCTACTCTTCTTCATGA
GACTGCATCACGCCGAATCTGTTACGATTCGTACGATCCCTCAAGAAATCATAGAGTAATGCTCCACAGTTCAGATCTGCCTCGTCTACCCAACTAGGTT
CGTCATATCCACGCCAATGCACCAGAAACTCACGGTAAATCCGTCCGTATCTAGTTCGCTTCCCCGATCTCATATCGGTGATCTTCTCGACTTCGAACTC
GTCGGCTTCGAGATCCACATTCCAACTGTCTTCCGGTAGGAGAACTTCGTCGAAGTCGACGCGGTCGGATGCATCTACCGAAAGACGGACCTGCGGCCGA
TCCGGATATTCTTTGACCAACTTCAGCTTGGATACGTGTACCACAGGGAACAGGCGATATTCGGTACCTGCCGTTTCCAGCCTCACCGCATGTTCTCCAA
TCTTCTCTCTCACCCGGAACGGTCCATGCCATAGATGGGCCAATTTGCGAGCGTACCCTTCTTTCACTCGATCCAAATACAGCCACACCTGCGATCCCAC
TTGGATTTGATGTGGACGGGCGTCTTCGTTGTGTCGATCCGCTCGATCCTGTATCGCATTCCGCAGTCCTTCGTTCACCTGGGATCTAGCTTGCCGGTAG
TATTTCGGGACTTGGTATCGCCATCGCCTTGGATCTCGGTTTCTCTTCTTGGTACTGCATACTGGAATGGCCGCTTCTAGGGTGGATTTGGGATCCCACC
CATGTACCAAGTAAAATGGTGTATCACCCCGGATCCTGTCTTGGGCGGTGTTCATCGCGAAGGGGAGTCGTTCTGCGTACTCATCCCAATCCCTTTGATC
CAAATCCTGGACATACATCTTGAGTGCTCTCGTGATCGTCTGCACCATGCGTTCGGCCGACCCGTTAGCTTGGGGACGATATGCCATGGTTGCTCGCTGT
CGCTGCCCTAGGATCCGGTTGAATGCTCGAAAGAAATCAGACATAAAGCCTGGCTCCCGATCATGTCTAATCATTTCGCTAGCACCAAATCTTCGGAAAA
CACACTCCTCGTACGATTCCGCAATGGTTTGCGCAGTTCTAGACGCACTAGCTTTGGCAATCACATATCCGGTAAACAGGTCCACCCAAATCAACAATTC
TGTGTTTCCTTTGAACGACTTGGGCAACGAGGGAATATGATCCATGGCTATGATCTGGAAAGGGTAAGTCGCTCGGACATTCCCAGGTGACTCCCCTTCG
ATCGTAGGTCTGCCTTTGCCTGTCTCACAATCCACGCATTCACCGACATATCGTTGTACACTCTTGAATAGTCCTCTCCAATGGAAACATTCCCGGATCC
GTTGGTAGGTCCGACCAATGCCCTGATGTCCGCCTTCCAAGCTAGCGTGGTAGTGGTGTAGGACATCCTGTTGCAAGGTTTCTGGCATCACCAATCTCAT
CAATCCATCCCGATCCTCGTGGACTCTCTTCGTAGGGGGGCAATAGAAGAGCAAGTCGTTCAGATCCACTGCGTAATCCGTAGCGATAANNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCTCCCAGGATCTCGTCTTCCCCTTTCGAACATTCACAATCTCCAGCGTCCAAGG
TGAGAGTAAAGCTGCCCACTGTCCCAACGTCCTTGCAACCCGGCCGACTTGAACAGCCAGGCTAGCGTGGAGTGTCGAGTCAGGATCCGGATGGATCTTC
CCACTAGCAGGTTATAATTTAGATCCAACACGCGCAGGAGCGCAAGTATCTCTTTCTCCACCGCTCCGTAGTTCAGTTCATTCGGCTTCAGTGTCCGGCT
GACAAAGGTGACTGGATGACAGATCCCTTCATGTTCTTGCACCAGAGCTGCTGAGACTGCCCAGTCACTGGCATAAACTATTACCGTAGGTTGACGTTCC
GGATCGAAATGACGGAGGATAGGTGTGGTCGCGATCCTGTTCCTCAGTTCCACGAATGCGTGTTGAGCTCGGATCCACCGAGATTCTGCCTTTTCCAAGT
TCTGATCCGTCGTCTCTATCCAGACTGGATCCTCTCTCTGTTGGTCTCGGAGTGGATCCAGCTCCTGTGTTAGGTCCTCTTCTGACGTCATACCACTTGG
ATCCCTTCGTGGATCCGACATCTCCCGGGCCAGAGCTCGTTGGATTTTCATCTGGACAGCTGGAGCGGTCATCGCAGCAAAATCTACCTCTCTTAATTCA
TACAACACCGCGGCAAACAGGGCGTAATCTTCGATGAACCGACTGTAGTAGTTCAAACTGCCCAAGAAGGATTGCATCGCTCGTAACGACTGTGGGAAGG
ACAAATCGGCTAATGAAGACAGGTCCTTAGGATTCGCCTCTAATCCCTCCTTGGAAACTCGATGGCCCAAGTAATCCACCTTGCGCATCCCCCAATAGCT
CTTAACCACACTGATAGAGAGATTCCACTTAGTACACGCCTCCAGTAGGGATGTCACTCTTTCGCACAACTGATCCCACGATTCCGCCGGGATCAGAATG
TCGTCGATGTAAGATCTGCGTCCTAACACAGACGGGGTCCCAGGGATCTCCTGGCTCTCTCGCTTCGAATGGATCCACTTCTGCGTCACCTTTCCCCGGG
ATCCACCCGTTTCGGGCTCCGGTATTCGGGTGAACCCATAGAGGGCGTTATCGATGACGCGTTGGTAGATCTGGGGTGCGTTCTTCATNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTTACCTCGAGCCTGATCTGACGA