Description :
From Genome Similarity Track
Location :
Scaffold_156:2345- 50786
Transcript NameFunction/comments
Phypl_g43545'-AMP-activated protein kinase subunit beta, putative
Phypl_g4355hypothetical protein PHYSODRAFT_361180
Phypl_g4356sporangia induced hypothetical protein
Phypl_g4357choline-phosphate cytidylyltransferase B
Phypl_g4358hypothetical protein PHYSODRAFT_286562
Phypl_g4359choline-phosphate cytidylyltransferase B
Phypl_g4360hypothetical protein PITG_14592
Phypl_g4361hypothetical protein PHYSODRAFT_259266
Phypl_g4362hypothetical protein PHYSODRAFT_354949
Phypl_g4363hypothetical protein PHYSODRAFT_511517
Phypl_g4364transcription initiation factor IIB, putative
Phypl_g4365hypothetical protein PHYSODRAFT_286559
Phypl_g4366hypothetical protein
Phypl_g4367prolyl endopeptidase, putative
Phypl_g4368hypothetical protein PHYSODRAFT_512486
Phypl_g4369hypothetical protein
Phypl_g4370conserved hypothetical protein
Phypl_g4371carbohydrate-binding protein, putative
Phypl_g4372hypothetical protein PHYSODRAFT_354946
Phypl_g4373conserved hypothetical protein
Phypl_g4374hypothetical protein PHYSODRAFT_511418
Phypl_g4375hypothetical protein PHYSODRAFT_302895
Phypl_g4376conserved hypothetical protein
Phypl_g4377hypothetical protein PHYSODRAFT_346938
Phypl_g4378hypothetical protein
Phypl_g4379hypothetical protein

Sequence
48441 bases(100 bases per row)
CGACTGGCATTCCAAAAgccatggccaagaagagcggaGGTGCGTCACCATGGCttcgcgcgcgtgctgcgcgactgCAATGCATCGTTGCGCAGCACCG
CATTGCATGGAGCTTACTCGCTATTTTGCACTACTGTCGGCGCAGGGTCGAAGTCCAAGGGCAATGCTGGCAAGAAGGCGGGCATGTTCAAGGCACTtaa
gaagcaggagaagcggTGCGTGCAATGGCGGCGTGCATTGTAAACGGTTGGGGTTGGCTGCATCTaactgttgctgctgttgctttgTTGCTTTTGGTTG
ATGCAGAGCTGGCGTGGTTGCAGCGGACAAGAATGACCCCCACAGTAACAAGCggaaggccaaggtggccaagcgGCCGGCGCCGGTATCCGACGAGTTC
CGCAACTTCGACGAGCGTATGGCGGCCAAGAACACGCGCCGACCAGGTCTCGTATCCAAGGCTGCGGCAGTGGCGGCTCCAACGTTCGTGATGGCAGCTC
CGACATTCCAGTTGTAAGCGGCAGCGATGgcttcgagttgctgcagttgctgtgGTGGTTCAATTGCCGTGCTAACATCTTTGTCGATTGACTCAGCAGC
GGCGTAAACCCTGTGCAGCCAATGCCGGCCCCGCGCGAGGTGGAAGGCTTCCATGGCTTCATatcggcgctggagactcCGAAGGATGCGCCGCCCGTGA
ACATGAATCAAACTGCGCGCCAAGCCAAGCCCGTGCTGCCCGAATACCgcggcagcaacgtcttcgcagtgctggacaacggcgacgaagagcagctgaA
GCCGCAGATGGCaccgcagccagcgccggTGTTCATGCAACCAGCGACGTTCACATTCGCGACCACCAAGCCGACGttcacgctgccgtcgtcctcgttg
caGTCCTCGCTGCGCCAGAGCCTGCAGCCGGTAGCAGGCAACGCAATGCGAGCAGAGGATATCGATCCCGACTTATAAGGCGGCAAACAAGCATGTACTC
AACACGTAACCCTGTTGTTGCAGGCGCATGTTGTACCCTCTTCAAATAGATATGTGGCACTATCGGGTTCCAAAGGTTTCGGCGCAACCTTCGCGCGACC
GTGCGGCGGTTGCGCGATGATGCGTCGCCGTTGAGGCTCGGGCTTCCTGCGGATTTCTATGTGGCTTTTTGTAATAGAGAGAAGCCAGCAAGGGCTCAGC
CGGAAGAGAAGCGCAGCCGAGCCGAGCAGCCCCGCCGCCAGCCGCAGCCCCGCGAGTGACGCCACTTTTGCAGCCCCTCCAGCGCGCAGTACACTACGAC
CGGAAGCTCCGTCTTCTCAAGCGGGCAGGGagagcacgcagcagcgaccagagcagccgccgcgtcgccgGGCACCatgggcagcgccagcagcaaggcg
gGCGACGCCAACCCCAAGAACTTGGGCGCAGACCCGAGCGACCCCAACGCGTTCCCGCTGCACCACCATCCGTACTACAACCAggcgcagtcgcagcagc
aggggTGCAACTTCGACGGGAACAGCGACCAGCAGAAGCCGTACTTCGCCGACCAGCACAACGCCACCGAGGCGATGGAGGTGGATCCGCCCACCGAGTC
CTTCTCGGACATGTCCTACGCAGACGGAGAGATGCCCAGCACAGCGCAGCTGGACGtgaaggacggcgagcacgCCCACGGGAACAATGCGCAGACCACG
GACGTCGCGGTCCCGCCCGGGGAGGACGTCGTGCCCATGGTGTTCAAGTGGGAGCACGGCGGACGCAACGTGTTCATTACGGGCACGTTCAACGGCTGGG
ACAAGCAGTGCCCCATGCACCGGTCCGGTAACGACTTCACGTACATCGCCAACCTCACGCGGGGGAAGCACATGTACAAGTTtgtggtggacgacgactg
gCGGTTCGCCCCTGACCAGCTCACGATGGCAGATGTGGAAGGCAACGTTAATAActacgtggacgtgtcggaCTTCGCGCCGCTCTCTGACTTTGATGGC
AAGAACAAGccgcaggacgacgacgaagatccCGAGAACCCGTACTCACGGTACATCCCCGAAATCGACGAGTACACGAAAGAGCCGCCCCCGCTCCCGC
CGCACTTGCGGCACATTATCTTGAACAAGGTAAGCTACATTACCCATTGTTGCATCGTGTGGTGCATCCAGGGGTCGTGCTGGTACTAACTCGCGTGTTT
TTGCGTCTGTGTTGTGTCATGGTCGTCCAGGCTCCGCCGACAGTCGATGGGCGGTTGCTGCCTGTGCCCCAGCACGTGGCGCTCAATCATCTATACTGCA
CAGCTATCAAGGACGGCATGATGGTGCTCGGCATCACCAACCGCTACAAGCAGAAGTTCGTGACCACCGTTTATTATAGCCTCATGCCCGGCGCCAACTA
GCTTTTGCCCCCTCTTACAAGAACTGGTTAGGCGGGTCGGTGGACGGGCGGGCTGATCTGATCCATCGGCTCAGCGTAGAAGGCAACACAGGTAGAAAAA
AACGGGAGGCAGCTCGGAGCCATGTCATGAATGATCCAAGTGTTGGACGCGGCGTGGGCATGCAGTGCGCGTGCCTTGCTCCGCTTCTGTAGGAAGTAGA
CAGCAACTCTATTTTTTGGTaaggagctgctcgcaaTGGTCGTAGCGAGCGGCAAGGGCATGGCCAACCTAGGAACGGCGAAGCCTAAAGCAATGACAAG
CGAACACACTACGTCTTCGTCCTTCCCAGCCATCGCCACACGCACTCCCACGACGCATGGAAACACAGCGactacaagcagcgcaaAAACAATAAACATA
TTtttgtcttcttctgcagcagcactaggCCAGCTCGCGTCAAGGCATCCTCGACTCCTTCAATTTGACGACTCACTGCACTCCATCTCACCGTGTCGTG
CTACCCTCCTCCCCGCAAGCTCTTCTCCATCAAAACTGCATGCTTCTCCTCTGCTTCGCGCtgtcgtctccgtcttctATCGCTGGAACGAGCTTCGGTC
TGAGCACTTGgacgcgagctgcagagctgccGGGCTGTCTTGTCGACTGTTTATACGTAGATCTCGGCCCacaggaagaggaagagcgaTCCgaagccaa
gcagcagagcggcgatgaaggccagcaccagctccgccagcgcgttcttcttgggggTCACAGcgcgcatgaagaagagcgccatgaagaccAGCCCCGT
CAGCAGGAGCGTGGCCGTGAGGAAGCCGTAGCTCTCCGGGTCCACAGGGCTCGCGTACGGGATTTCCTGCAGCGCACAGAGGCGGAGGAGAGGGTCAGTA
GCTGCAGACTAAGGCACGCACATCGGGTGATGCACACACGCAGGACACGCACCATTTCCATCGTGGTGAAGTATCGAGATCTGCTCGGAGTTCTTGCTTG
ACTGACACGTATGAGCTCGTATGAGATATAAGAGGTTGACTATAAGATGAGAGGGGGTTTAGAGATGGATACATTTGCGACTCGGTGCTGTTCAAAACAG
TGTTTTGACCATGTGAAGCAGTAGGCGTCCGCGCAACAAAGTCTGGTATATTGTCGTGTATGCCCAGCATAAATACGAAACTTACTCGGatccgtcgtcg
tcatgcATCGCCTGCTTGAGCCGCTGCACGAGTTTAGCCTTGAGGCCCTTGGTGTCGAGcccgcgcttcttgagctccgctCGCAGCTCGGTCACCTTCA
TCTTACCGACATGGGCGGCCGGGTCCTTCTTTGGCTCGACGGGCGTTTCGGactcggcgccgtcgtcttcctgctTTGCATGGCTATCACTATCGCCATC
CACTGCAACATCAGGCTGACTTGCAGgcgctgcttcctcgctctccttctcgacACCAGCCTTACCGCTCTGCTTCGGGCTCGGGGTCACCGATTCCTCC
TTCACTTTTCCTCGCTCCGTTTTAACACGACTGGGGGATGACGTACCCGTGTCGCTGTAAGTCGCGATGGCACCATTCGGCGTGTTACGAGTAAAAGTAC
CcttctcgtcttcgttgCCACTCTTCGAGTCCGGCCTGACCATAGACTTGCCGCCCTTCTCTCCATCAGCACTCCTGCTGGTGTCAGCAGCACTATTGTC
ATCCGCTTCACTACCCGACACACTGTCCTGGACAAcgtcctcgtcttcgacTTCCATAGTCGATTGTTTTGGTGATCCACTGGGGTCCTTGCCAGCATTT
TCCTGCCCCCtcttctcgccctcctcgaGCTCTTTGTGGACCTGTTCCATGTCctcatcgtcatcttccATTGCGTCATTGCTTTTCGCTCTAGATGCTT
GCTCACCAGCAGTTTTCACCTTCTCACCCTTCTTCgccgcttccagttcttcgCGCAGCTGTTCCAACTTGGTAGCAAACTCAGCTTCGAACTTTCGCAG
TTTTTCCTCTTGAGTCCGTTCATTAGCTTTCATCTTGGCTTCGTGAGCCTCCATAGATGCAGCAACCAGCTCGTTGGTCTCCTTTGTGTGCTTTGCTGGG
AGATAGTAGATCGGCGGAGACGCGATAGTAACCAGAAACTTGGATTGACGCTCGCTCTTTCGAACCATCTGCAggtgctccagcttggcgcgaGCAATCT
GCTCACTGCGGTCAAGTTCAGTGCGCACCATCAACGCCTCCACCCGTGCCACCTCAGCTTCATGACGTGCTTGATTCTCCAGATTCTGGCTCTGTATCTT
CTCCCTCTGTtcggcctcctgctgcttcgtgtccTGGCGCTTAAACAAGTCCGTGTCCTTCTCAATTTGCCGCTTTGCCTTGCCTAGATGACCCATCAGC
GCGCCGAACATGCGCCTGCTGCGTGCAATACCTTCTTTCTGTGCGTACGGTGCCACTGCACGTTGCTTCAGCTCCTGTGCGCGAGCGCTGTTCGCAGGGG
GCGAGGCAGCCGTAGTGGAagtcctgctgctctccgcCCTCCCTTCAGCGCGGTGGTCGCCCTCCGGCCTGGCCACTGCGGAGTGCAGTCTCTGTCtctt
cacggcgctgctctgCCTATTGTCCTCGTTGTCGCGCTTCCCCAGCCTCCACGAGGCGTTGCCCCGCGCGTtgttctccttgagctggaCAACCTGTcgg
cctgcgcctcctgcgcGCGTCGGCTCGACGCCAAGTCTAGCAAAGACACTGCGTCGACCTGCCCCTGctccggctgctgcggcgcttCCTCGACTCTCTG
TAGATAGGAAGGAAAGGCATCAAGAGCAATTAGATGCAAGATCGCAACGCAACGTGGGGCTTCAGTGGCCAGCTACGCGGCGCCGAGGTGTCTACAAGCC
ACACAAACAGGCAGGCTAGGGGAGAAGGACGTACTCGGCGTGTCGAGTGCCTCGCGCctcttggccagctcctgcagctcgcggtgcAACGCGCGCTCGT
CCACCGACTCCACCCGATCCGCCATCGCTCGTGGTCGGCCTTTGGTTTTGGGGAAATTCAAGCGCCATCCACTTTCGACTGACTTGTGAAAGCAATACAA
ACTCCAAGTCCATCTGTAAATGGTGTTTCGTACACAACCAACCATAGTTAACGAACGTCCCACGGCGCCACTTCAAGATGGCAtcacctcgagctgctgc
aacggacgacgcggtggccaaggcgctAGACCGGCTACGACTGAGGAAGTCGGGGGGATTAGGTGGCGAGTATGGAGACGCTCCAGCAGTAGTGACACCG
ATGCCAACGTCCGTGCCAGCGGCGCAACCTGCTGCCGGATTCCAAGTCATCTGCTCCGGCCAAGTGGAGAGCGTGCATGTACGTGTCCTCGCCTGCACAG
CTGGAGTGTGAGATCACACTTGGAAGCGATGCACTAATATGCTTACTGTTGCGGCCATCAGTACCCGGGCGTCACGAATGTGTATTGCCGATATGCCATT
ACCTACGGCGTTGACTGGCGCGTGCTTCATGTGAGTGTCCGCACTGCAGGCTTTCGCTGACACCTTTGGCAAACACCCGCGACTTACCAGGACGTATTTG
CATTGCAGGGGGCTGAGAACGGACTCTCACAGATCGCGTACCTGGTCAGCAATGAAGACGATATTCTGCTTAGCTTCCCCATCGACGTGTCCTTCAAGAG
CACCAACCCGTTCGGCTGGCCACGACTGGTGCTTAGTCTGTACGGActcgacgcgctgggccGCGATGTGGTGCGAGGCTACGGCTCCGTCGCGTTTCCT
GTTACCCCGGGTTGCTCAGTGCGTgagctgccgctgttccGGCCACTATCATCGTCGCGGATTCAGCAGTTCGTGGCGTGGCTAACTGGTTCACCGCCCG
AATACTTCGACTCGAAGTTTGTGGCGCAGAGCGACAGCCGCGAGGTAACGCGAGTCACATCTGCAGGCAAAATACGGGTTGTCCTGAATGTCGCGACTCA
CGGGATGAAACAACACGGATACACATGAGCGAGAATATGCATGTCTTGTCATTTCTCAGTGGTTAATGATGCAAGTCGTCGTACCAATCAAGATGCACAT
ATCAAAGCTAAAGACCTGCACAGGTAGTACCAAGCCCCCTCGAGTATAGGCAAGAGGGGCCTCCCCGAGACACTTCTCACTGCAGCTTCTCTTAGCACAA
TCCTTCACGCGCCATCTCGGACATACGCTCCGATAACCGCTCCTTGATGATCTTTCGGCGCTTGCGGAATGATGTACGCTACGTAGCAGAAAACAACGCA
GTTAGAGTCTGCCTAGAAACACGACGAATTGACAGGGAGACGTCAAACTTACCAGACGGCCTTCCTTGCTGAAAAGATCCAGGAAGCTGTGCTGCATGTC
GTCGGCCTTGCTGATCCACTTGTGCACGAAtccgtcgacgtcgttgcGCACCTTATCTACTGCCATATCGAACTTGATACTCTTCTCCTTGATGAAGGGC
ACGTTCATATCCTTGCCCGAGTATCCACGCTGCAAGTTGCGACGGATGAACGTGTCGTACTCCGCAATGATCCGTATGATGAGGTCCGACGTTGAGATAC
CATCCGTACGCCGCGTCTCCAGGAACTTGCCCATCGCCTTAATACGGGCGTACACATCACCCTCCGACGCCTCACCCGACGCGTCCGAATACGGCAGCGC
GTCATGGCACACGTAGTCAATCTTGTGctcctccaggaactcgtccGAGAGCACCCAGGGCgcgtcctccaccacttCGTCCACCCACTTGCAgtggcgc
agcgactcgtaGCGCTCCTTGTCCGTCATGACAGTGCGGCCCTTCAGTTTGTGCGTGATCtcatcgctgcagcagccgacgaTCAAATGCGTGTTGGGGT
AGGCCACCTTGCATTGCTGCAGAGCCTTGGCATGCCCGAAGTGGAAGAGATCGAAGATGCCGTCGGCGTAGAGACGCAGGGGGCGGCCGGTGAGAGTACC
GggctcgccgtccaccagtGTCTTGCGGAACGGCTCCGGCTGCGGCTCGGAGTCGCCGTCCTGGCTGCTaacgctgctgttgtcgctggacTCCTTCGGA
TCGTCGGCCGCGGGCTtcgcctccaccttctcggcGGCAGGCGCATGGTGttcggcctcggcctcctccacgttGTTCATCTCGGTGGCACGTCGCTACA
TATCACATATTTACCGCGAACGTATCATCAGCACCGCAGCCATCTTCCAGCCTTAAAACCGGGGGGACCCCCGAGCGTTTCCGTGACGATCTTTGCATCA
GTCGAAGCGGAAAAGACTCGTACACCCACGGCATGCGGTCCGACGCGGGGAATCGCAGCGCGGCAGCGGGGGAGGCACGCACCTTTCTCGCCATCTCGCT
TCTGTTTCTGTTCGGTCGAAAACTGTAGTGACGCGGGGCAAAATTGAATCGTGCGTACTCGTATCTAGCGCGGCTAAGTACGATCTGTACCGTACAATAG
CAGTTTAAGGCAGAGCGAGCCCGCCTGTTTCCGATCGCAAATGTGACGCGTCACcatcaaccacttcaacatcacgATATGTATTTTGGTAGGATATAAC
ATAAAATAGATGTTTAATGACTGCAAATGTCTGCAATTGAGTCCTGTAGTCATATCACAAAAGGGAGGTGCATGCTCTTTAATAGGTTActgcgtcgaca
gcgacgccacgcgAGTGCTGCCCGAGTACAGCTTGTGCGGCACGTTGGCGAGCTGGTTGCgctccgtggccaccgcgGGCTGCACGACGATCGGCACTTG
CCACTGGAATgtctgccgctgctgctgagagTTTGCGGCAGTGCCcttctgcggcggcggagcgcCCGCCGAAAAgtcgaagcgcagcagccactggAAG
CGCACCAGGTCCGTGTTGATGGTCGGAAGCGCGTCGTGCGGGATGCTGAAGCGCACGTTCGTTTGCAGCACGTCCAACGTGCGCTCGTGAAAACTGCCGA
ACACTTTGGACTGCACGACGCGGTCGGGATCCAATGCCATGGACGAGAGCGTCTCCTCGAGACACAGCGTGGCCGATACCTCGTAGCACGGGATGCTGGC
GCGAGTGAAGTCAAACACTCCCAGCAGAACCTCGCCCGGCTGGTAGAACTGCTTCgtcagcaggaagcgcacgAGGTGACTACTGTCCTTGCCGATCGTG
AAGATGCTcgtctgcgcgcgctgcatctgctccgTTTCCACGCGGCCATGCATAAGTGAAGGACGGAGCTCGAAGGCGATCTCGCTGCCCTTGCGCACGC
CGACAGgtgccagcgccaccgagGCGCTTCGGTCGAGGCGCCCGACGCGAGTAGTTCCGCCCACTACCTGCTGATTCTTGGGCGTGGTCTCGACGCTTTT
GTCTCCagacgccgcgctgccgccgccctTGAGTTGACTCGCCGCAAGGTGGCTAGCGCTAGCCACGGTGCCGGCCTCGAAGAAATACTCAGGCCCATAC
ACCTCAAACGGCAGGTGCACCGACACAGGTTTACTCCCGGCAATCGCACATTGCGCCGTGATGGAGACCACGTAGAAGACCCTGGCGGACGATCCGCGGA
AGGTCGGGCAAATGTTCCCCGGTAGTGCGATGGCGAACTCCCGCGTGCAGCGCTCCGCAGTCTCCTCCCGCGCCGCCTCAGTCGCCGACACAGGGTCCAT
AGCTCCGTGGCTCttagctgcagcagcgctcaGCTCGGGCTGGGTCGGCGAAATGTTGATGTCCGAaagcagcaccgacggcgtcgagcgaAAGATGCAC
GTGCCCGTGTCCCCCGAGAAGTTGCGCACGTccggcagcacggcgcccatcttgtcgaacagcaccacgtcctcggaCAGTTTGTGCTCCatctgcgcgc
gctcgtcctGCGACGCCGGGCGGGGCGAGTTCACATGCACCACAggcagcgtcagcaggttGCTGTCCACCGTGACGTGGCCGTGCACCTGCGCCACCAC
GTGGGAGATCTCCGAGTGTGCGTCGGGCTTCTGATGGCGGCTCACGAGCCGCACGACGCCcttgacgacgccgccggGCCGGAAGTGGCGGCTCGCGAGc
cgcgccaccagcacgctgcccTCGCCGGGCTGCATGACGTGGTCGATCGTCATGGTGTCGAGGGAGTGCAGGTTTGTGGTGTACCGCACAccaaagttga
agtgaggtCGTCCTCGATGCTAAGCTAAAGCATCGCGTCCGTCCTCTCCCACCAACGGCAATGCGAAACTGAACGAGTCGGCTGTCGCTGGCGAAGGGCG
AACCCCAGCACCTGAGGCAGTGTTGGCCGCAgcgctggacgcggtggCCCATCAGCGAGCAGCCACTCCAGCTTTCTCTCGGCAACGATCAAGACCAAGT
AGCGCTTCAAGCATGGCCCCGGTAGGCTGAGATTGACTTCTATGTTGCTCTGTGTCAATGAATTCACATTAACTTATAATGCGTTGATACCTCACAGATG
GCATCCGACGCAAGCAATGAACCCAAGCAGGAACTTGGCCTGGACAACCCTGCGAGCTCCGACGCGGCTAACTCAACGAGCACCGAGTCGACCAGCTCGG
CGCCGTtccgcaagacgctggtggacggcgagccCGGTACTCTCACCGGCCGCCCCCTGCGTCTCTACGCCGACGGCATCTTCGATCTCTTCCACTTCGG
GCATGCCAAGGCTCTGCAGCAATGCAAGGTGGCCTACCCCAACACGTATTTGAtcgtcggctgctgcagcgatgaGATCACGCACAAACTGAAGGGCCGC
ACTGTCATGACGGACAAGGAGCGCtacgagtcgctgcgccacTGCAAGTGGGTGGACGaagtggtggaggacgcGCCCTGGGTGGTCACGGATGACTTCT
TGGAGAAACACAAGATCGACTACGTCTGCCATGATGCTCTGCCGTACTCGGATACATCGGGTgaggctgctgaaggagatgtGTATGCGAGGATCAAAGC
AATGGGCAAGTTCCTCGAGACGCGGCGCACTGATGGTATCTCTACGTCGGACCTCATTATCCGAATCGTCGCAGAGTACGACACGTTTATCCGCCGCAAC
ATGCAGCGCGGATACACGGGGAAAGACATGAACGTGTCGTTCATGAAAGAGCAAAGCATCAAACTCGACATGGCGAtggacaagatgaaggagcgTTTTT
CCAACATCTTCAGCCGAAAACCTGGTCGttaccagcagcggcagtcTGTGTAGGCAGGTGCTGCACACTGTGCAGCATGTAGTAGCTAGCACAAGGGGTG
AAAAAAAAAGCAGGCAAACCAGGTGCGGCCTCAAGTAGATAGATCTTCTCCAGTAGCCCAACCTTGAAAGCGCTTTGCCATTGAGTTTTTATCTTACCGA
GGAGCGCTAGTGACTCCGTACACAGCTCGCTGAACGTTTTgcgcagatgctgctgcaactaGCAATGCTTGTAGGGCTGCAAGAAATACAAGACAGGATA
CCAGGTCAATACAATCGGCAAGCGAATAAGCCAAACAACAACGTACCATTCGTGAACTGCTTCTGCGCCTGGCGTAGGTCACTGGGTGGCAACGAGCTGA
ACCAAAGCAGCGGATCCGTGTTCGGCCCTACTTTAGTACTCCCGGCACTAATCGAACGTTCTTCCTTGTGGTTCTTGCCTGCTCTCCGATGATGTAGCGA
CTCGCCACCACGTTCCTCTCCAACCCCCTGAAGCCTCGCCTCCGATGCATCTCGCAGCCTCCAGTTCCCCTCAGAATCCAGCGATACCACGCGAGacgcc
tcgagctcctcgtggtACGAGATCTCAGTCAGCGCGTGCTCAGGCAACCGCAGCTTGGCCTTTGTCAGCATCAGAAACCCCTGCGCCACACGACGTCAAC
ATGCATCTATTGTAGACCCacgctcttgctgcagcggagACGCACCTGCTTGAGCTTAACACTCGCGACCTCATGCTCGTCCAGATACTCCTCCAGGGCC
TCCACGCcctccaccagcacttcGTCCGCAGCGTCCGCCTTCATCTTGTGTCTCCGATCTTCCGTTTCACAAAAAATAGAAATACATTTCTATCGGCCCT
TTTCCAGCCAAGCTGCTAAGCAGGATCAGgatggcgtccacggcgcgcAAGCAGATCTCGCAGGAGACGTTCGACGAGTGCGTGGCCGAGAATGAGGAAG
ACTTCGACatgtcgctggaggaggcagtggccgacgccgtgcagcagttcgagtCGCAGGGCGTGGATCTGTCCAACATCATCAagagcggcgcggcgca
ggcggCCGACGGGCAGGAGCCGCTGCCTGCGCGGCTGAAGCGGCTGGTCTTGGAGCTGCGGGCGCTCTcggagctcaagagcgagcaggaccaggtgctg
ggcctcgtggccgagctgcagagcgtcTGTGAAGAGGTCCCGGAGGCGCGCGTGGTAGCGGGGCGTaacgacgccgtggacacgctgttgacgctgctgg
atgccgaCTCCGCCACTGTAGTGGCGTCTTGCAGCAACctgttggcgttgctgtGCGCAGACAATGCAGACAACCAGGACTTTGTGGGCGTTGGAGGGAT
GCAACGACTTGTGAAGGTGTTGAAGCGTCAGCGGGAAGATGCGGAGACTGTGGTGCGGGTGCTAGCGCTCATGAAGGCGGCTTGCGTCAAGCACGAGAGC
AACAAAGCGCATTTTACCAAATCAAACGGAGTTGAGGCGCTGTGCGGACACTTGGATCGAGCAAGAGACAACGAAGTGCTGTCGAagcagctggcgctgt
gCTTCCGAGTGTTGACTATCAACGACGACCCGCGGGCGACCTTCTCGCAGGCGCAGGATACCGTCAAGGCTCTGGCCGAACGTGACGTGATCCCGTATAG
TTTAGACGTCCTGCGTCAAGTTGGACGCAGTGATGCCGCAACTGCATCGAACACTTCGCCGGATCTGCTCGTCAACTGGCTGGCAGTACTCAAGCAACTT
GCCGTGACGGAGGAGAACTGCCAACAGATCGCTGATCTTGATGGTTTGACCACCGTGCAGGAAGTAATGCAGGCGTACGAGCACAGCGCGCCTGTTGCCA
AGCGCTGCATTACAGTTTTCCGGAATGTGGCGGCTGCGGATGATCTGAAGCGTGCAATTTTGCAGTCTGGAGGAGTCGAGCGGACTTTGCTGATCATGCG
GCGCCACGAGACCGATGCATCCATCCAGCAAAACGCGTGTGCTACGCTAGCTGCTATTGCGCTCCGCTCTCCAGAGAACAGCCGTGTGCTAgtcgagctt
ggagctgTTCGGCAAATCTCGCGAGCCATGCAGGCCCACCGCCGTGACGTGGCTGTCTTGCGCCAAGCGAGTCTGGCAGTTCGCAACATGGTGGCGCGTA
GTGTGGAGCTGCGTCCGCGCTTCTTGTACGATCAACCAGAGATCGAGCCATTGCTTCGTGAAGCACAGCAGTATCGCGACTGCGGTGACGAAGCCTACGC
AGCGCTGCGCGACCTGGGCTGCGATATTCAGTTGTCTTCATttggtactgctgctgtttcagctgctgcgtcgggGTCCGTCAAGGCGCCCACGATCAAG
CCGCGCTTCAACCCGGTCCAAGCTCAGTCCAACGAGTTGCTCGACAGCGTagaagaagctgcggagGCACCATTCGCCCAGTAGGCAGAGATCAAAACCA
GCTGACAGTCAGAGGAAATTCTTCAATTTTCAGTTTTCAGTCCTCCTTCCTTTCCTACCATGCACCTGCCTATCCCGACCGAGTTCGCTGTCCTCCTTGG
TCCTCTTTCGCACTGCTTCTTCAGCCTTGTCGTATATTGCTGCTCACATCCCGATGTCATCGCTCGTGGTCTGTAAGGCTACGCTGCGTGACGACCGCAT
CGAGGCACGCATGACGCAATCCTTGCTCTGGATCTTGTCGGCTCGGAGCGGGAGAAAAAAGGAAAGAGAGGCAAGGCATTGGCAAGAACGGCAGACActc
tgctcctgctgcaaaCCCTCATCACAGTGCGGCAGCGGAGAAGAGGCGATCCGAGCTGTGCAGTGGCAGACAACGCTGCGGCGCGTCCGACGAGCGAGCC
GTTTATGCGATCGCCTGCCAGCTCTGCTCGACGATCTCGCGCACGCGGCGGTTGTACTCCCGTCGGTTCTCCTGGAAGAGGCGCGCGGCCTCCGAGTTGG
CCGGCGAGTTCGGGTTGGggtcgcacagcagcgactggatGGACGTGAGGATGGCCGAGATGTCGTAGATCGGCGACCACTGGTTCTGCAGGATGTCCAG
ACAGATCTGGCCGTCGTTGTagactgcagcggcagcacgaacTCTCGTCAGTTACCCACAGAAACAACACAAGATATTAGGAGGCACTTTGCGGCCGCGT
ACTGTTGGGGTGGAACATTTTGGTGATGAACTTGACGGTCGGCGCCTTGTTCGGGTAGTCTTCGCTGAACTCGAGCGTCAGGTTGAAGGTGCCTCCCTCC
CAGGGCGTGTCGTCCGGTCTGCCAAGGTACGTAATAGTCAGTTAGACGACGGAATTATGGGGGTCAATGCGACGCTGGGAGGCGCTGGTCGTACCCGAAG
ATGACGGCCTGCCAGAGCATGATGTTGTTGTCCATGGGGGCGCCCGACACACCCGAGGGCGGGTCGTTCTGAAGCTTGCGGAAGTCGCGCATTAATCGTC
GGCGCGCGGCGGTGGACATGGCTGCAGCTGCTACTGGGCGGTGGAGGGGGCGGGGCGACGACTCCGCACTTCGGTGGCCTTGGACTCGATCGACTATGGA
AGAAGAACGTCGGACATTCGAGAAAAGGCCTCCCTGGCTATCACGATTGAAACCGATTTGGAGAGGATTTTAATAAGTACGGTTTTATATATACGAACTT
AGCAACTTTGGAGACCGTGCGTGCTTTAAATGCTTGCCGCGTTTCCGTCGGAGGCTGCGGTGGTgtcgacagcggcgtcgGTAGTGGCATCATCGAGCTT
ATCGAGCGCTCCGCCTTACACGGAGCCGTGCTTGACACCCACGAGGGGTGAGCGCGATGCTGGCTAGGAAACTGCGCCACAGTGTGTTCCTGAACGAGGA
GGGCAATAGCCTTTGCACAGCGCTCGGCTGTATAGGCAGTCTGTGCAAGTTGCCCTGTCACCACGAATTTAATGTCGTTAGCAGGCTCATGTTCCTATGG
TGCTGGCATGCCGTGCACTATTAGCGTTGCCAAGCTTGGACAATGCTGGCGCTACCGTCTACTCTGGCGCGCGCGTCACAGATTGACTCTGCTCACGCCC
TTTCAAGTCCAGGTTTGGATCGCGACTATCTATAGCTGCCGAAAGATTCGCGCCCTGGCGTCCGCCCGTTTGATTAGCATCGGAGCGCCGAGTGACAAGC
ATCGAGGCTGCAGAGGCGAATGtccacggagaagctggtgccCGGCGACGGCCACAACCTCGTGGTGTTGGCCAGACTGGAGGCGACCGGCATGAAGACA
GTGAGCGGCTACTCGTCCGCGTACGACGACGTGTTCCCCACGGCGCTGGATGGGATCAGTAAGGGCTGACGCGCAATCTTTCATCGAATTGCAACTAGCA
CGGGAGCACTTTGGATCTTTGGAGTGGAGCTCATTGTCGTGCTGCTTTGTGTGCTGGATGTTGCTGCCTGCAGTATCACGAAGGGAGTTCAAGTTCTGCG
TGGACGTACTCAATCAGACGGTGGAGGACTACTTCCCGTGCCTCCCATGCTATGGTTGCGGATATCTGTGGTGCTTCACAACGTGTGGACTGTCGCTTTG
CTTCTCGGAACCCTGCACCAAACAGGTACGGCAGCAGCGGTCTCAGATGTTTGTACTGATCCCCTTGGCCTTCAACTTTGACCATTGCAATGTTGCAGCT
CTCGGACAActtggagctggtgctgcgtcgGCTCAACAACCGAgaggagctgctgtaccGCGGCGTAGTCTGGAGTCTCAAGAGATGCCAACGAACACAC
ACATCCTGGATAGAAATCGCTCAGCTCGTCTACGAGTGACACAAGATACCAGTTTTCGCTTGTCTGAAACGGCGGCACCAAGCAGGCAAGGCATAGCCCC
AAGCATAGGCTCTAAAACAGTGTGTCGCGTCGGAAGTCAACCAATAACATTACGTAGTGTACAACAACGACATGCTTGTGGCATCACAGTCGTCCATGCG
GCGGTGCATCATGACTGCGTCCAGTTCTTCTATTGTCTATCTCTATGTGTCTATCTATATCTGACCTGGAAGCAAGAAAGGCAACACCAAAAGCACAGCG
TCAGTTGGATACACCACATAAGCAAGCAACAACTAGCACACGGGGAGCTACTCTCGGTCACGAGGTTTCTTGATTGGTCTTACCATGCAAATAGGAGGCG
TGCGAGCCTCCTATAAATATATACGAACCTGAGTGCACGGTGGCCCTCCTTCCTGTTTACTTACGAGGTCTTCTGTCTGCACACTCAGCACCTCCATCAC
GCCTCTCTTGGCGTCACGGTCACCACTCGTCTAAGTCATCACCACGCCTTCAAAGAGCACCACACGGCTCTTGTTCAACTCCTTGCATACTCTCTTCATG
CTCTTCTCGGCAATCATCGTTACGTCGCTAATCTCCTGGATCGAGCGCTTTGCGTTCGTGTACGCAGCCACCAGGTAGATCACCGACGCGGCCACAGCAA
CAGGAGGCTGGCCATTCGACAACTCCAGACTGTCTGCTTTCTTCGCCACAGCGTGTGCAATCATCTGTGTCTTGTTTGGCAGCCCAAGTCTTGAGCAGAA
GCGCTGCACATATTCttccgtcgtcgcctgctTCACCTCAAGATCCAAGCGGCGCTGCAAGCTCATAAAGGACTTGCCGATACGTCGCTTCGGGATGCCC
GAGGCCTCTTCAAATTCCTTCAGTGATCGGGCATTGCCAGCCTTTCTGCACGCGATAAACAGCACTGCGACGGCCATGCTTTCTCGTTCCGGACCGCGCA
TGTTCACACCCTGCTTCTCCGCTTCCGCGTACACGTCCAGTGCGATCTCCACAATCTTCTTCGGTAGCGACAAATAATCCGCGACTTCTTGAATGCGCGC
CATGTTGCGCTGCATCCTCTTGACCTTGGCGCTGTCGGACGAGATGTTGGGGCGCTTGTGCTTGCGCCCCGCATCGCCGTCGGCGCCCCCGCCGACCTTC
TTCGGGTCGACAAGATACGTGGACAGCGAGAGGCTGTTCAGCCGCGCGTCTGCGACGTCGCCGACCCTGGATTTCGCAGCGGGGTCACCACCCCGGTCAT
CATTAGCAAACGTTCGCCATTCGGGGGAATCATCTATAATGCGCTCACCGAGGATCATGCCGCAGGCGCGGCACACGACGTCGCCCGCGCTGAAGTCCGT
CACGACGTCTTTACTTCCGCACTCGCGGCAATGATCCGGCACGCACTCGCCTCCCATAATTAATCACTGGCTGCTGtgtgttcttcttcttccggtTGTA
CTGATGCCCAAACTCGTCGAATCGGGGGGAATCGCAGTGCGATCGAGAGAGGAGTCGCCGGAGAATCTAACGCGCCGTCTTCCTGGGTCGAAATCTGCCT
GCTAGCTTCACCCACGCGAAGTCTAAGATGGCTTGAGCtctgctcctccttgctgGTGGCCGCGCCTTGTGAAACCACTGCGATCCACCCACGCCAGTTT
CGTGTTCCGTACATTACATACTATATTCCGAAGGGGATGGTGTGGACACATCACATGTATTAAATCTAGCAATTAGTGACACGAAGCACCACGCGCATCT
TGCAACCTCCTCCGACCCTGCTCTTCTctgtgctgcagcctgcaggcAGTGCAGATGCAAACTATTCGCAGCACCAATACGCGTGGATGTTGCGCCTATT
CTGACCCTTGAATCGCTGCAATCCGCCTCGGAACaacgcgcgctgcagcagctttctCGACAGCCTCCTCACATATCTTCTCTCCGTCCAtctcttctcc
ttctcctgcaaCATATCTTCTCTCCacccagcgccttctgcatcATCGAGCTGAAGCCTAGAATTTGAAGCCCTTCTTGGTGAGGTCAGCCTTGGCTTCC
ACCACTTGCCGGTCCAGCTCTTTAGCCGCCTCAGGGAAGTCCTGCACCGCCATGACGGAGAGCGCGATCACCGCCAGCGAGTAGGCGCCGAAGGACACGA
GCGCGTACATGGGCAGTGCCGTCACCACCTGAAGCATGCGCGGGTTCTGCACGGGGTCGGCCGCATACCGCAGCAGTAGAAGCCACAGCGCGAGCAGGAC
GACAAACGCAGCGAGCCACTTCTGGTACTTGAGCATCGAGATGGCTTTTCCAGTGTGGTCGAAACGAGAGAccgcttttttttttcgggACGATATCTCT
AAAAGGAGTGGTCAAAATTCAGCTTCCCGGCCTCTGATTCGCTGTGACACCTGCTGTCCAAAATAGATGGTGGGAATGGTCCTCCATTCTGCAGCTCACC
TCGTTGTAGCTGTTCGTCCGCAACAGTGCCGCCCCCATGGCGAGTCTCCAGCCCCTGCCGGACGCATCGGCCTTCAACTCAGCGCCTTCACTTGCCAGCG
AGATGGACGCGCTTGTCGAGGACAAGGCGCAGGCGCGACGCAAGCCCAAcatgacggacgacgagcgcctcAACATGGCCGACTTCTTGCTCAAGCACAG
CCAGGGCGAGGCTCGCCTGCCCCGTGCCGTCATCACCGCCGCTGCAGACAAATTCCAGGTGCACCGCAACACCGTGTCGCGCATCTGGAACCTCATGAAG
ACGGCAATGGACTCCGGTGCCTCCACCGACGTCGTGATGAAGCAGGTGCTGTCTAAGAAGCGCGGCAACTGCGGACGTAAGAAGAAGGACTACTCGGCCG
CACTGGAGCGGGTGAAACAGCTCCCTTTGAATCAGCGCGGCTCACTTCGAGCGCTGTCGACGGCTGTGGGCGTCCCACGCACGACGCTCTTTCGCTTACT
GCGGAACGACTCGGGTAGTAGCCCACCAGACACGGCAGAGGACGATCGACAggagaccagcagcaccgaatCTAAGCCGACGATCGCCAACGCGATCAAG
CCGGCGCTGTCCGATAAGAATAAGCGGGAACGACTGCGGTTTTGCTTCGGCAAGATGCAACCGAACGGGGTGTTTGACGACATGTTAAACGTCGTGCACA
TCAACACCAAATGGTGCGCGCTGCCGGGCAGTCgcgacgcgaagaagacgaaggtAATGTTCCTCGTGGCAGTCGCTCGGCCTCAGTGGGATAgtgaacg
gcagcagcagtttgaCGGCAAAGTTGGTGCATGGCCATTTGTTGAGACTGAGCCAACGTATCCTGAGGCCAATGTGCTGCCTTGGGACCAAGCAGCATCG
CTAGTTGGGCGAGTGTTCCATGTGCTGGAGTcgatcaccaagaaggagattCAGATCATGATTACAAACTGTGTCATCCCAGCGATTATGATGAAGATGC
CCCGTTCGCTGCGCAACAGTCCGCTCTTCATCCAGGTTGACAATCACCAGGTGCGATTAACGTCTGATGACCCCGTGGTTGCAGAGCACGGCAGGACAGA
CGGATGGGATATGCGGGTGCAATACCAGCCAGCTTACAGCCCAGAGCTCGTTGTGCTCAACCACAGCTTTCTCAAGAATATTTATCCGGAGATGACGCCA
CCGCAAGTTCgcaatgctgctgcgcagctGGCCCCCGTCGAAGAACTTATTGCTGGCGTGGAGCGCGCATTTGCCGCACTCCCCGAGCGGCAGATTAACG
ATGCCTTCCTAGCCTTGCAGAAGACGATGGAGTGCATTATGCTGGCAGGCGGCTCAAATGACTTTGATTCGCAAGAAGACGCGACCAAGAAGagtctgca
gcacgacggcagTTTGCCCGTAAGCGTCTTATGCAGCCGCGAAGCTTTATTAGCGTGTCAATCCGCCTTGAACCCCCCGCAGAAATGAACAGCTCCGTCA
AGTCATTAATTGTAATGGCAGGCGCCCCGGACCTTTTCGGCTTGAAATCATCGCAGTGGTGTTTGTTTGTGCTTGCGAAGCCGGTCTGCTTCAGTGGGCC
GAAAGTCCAACTTGTCGTGCGTCAGTGCCTTGATCACCGCCCAAGCAACATAAATGCCCAGTCAATGCTTCGTTCAGGTGTGAACGACAGCAGTTGTGCG
GCATTTCAAGCAAATGTTCTGCTCTCTGCTGCCGCATGGGCTCTCGATCTCTTTGAACGAGGCGGTCAAGTGTGGCCGTACGAACGTCGTCGTTGCCTTG
GGTCACGACCGACATGGGAAACCTCGCCGACGCACTTTCCCGCCTAAAGAGGGGCGAAAACGGCGAGGAGTATTAAGCCGCTCGTCAAACTGTTGAGTAG
TGTTGAACGCCGTTGTAGTTTTGagcatgttgaagttgaattGTGTGCACCACACAACAGGGCATGAATTCTCCCTTTGCCACCAATCACAACCGCGAAA
CTTGGTTGCGTCCAGTTCGAACTGTCTCCTCCACCCAGTCTTCCTGCAGAAGATCAGTATGGCCGAGCTGCACTCAAACCCCGTTGTCGCTGCCGAGCCC
TTgtcggaggtgctgctgtccgtcgcGGAGACGGTCGTCGTCACGGAGGCTTCGACCGAGAGCTCTAGCCCCATCTCCtccgacaagaagacgagcgCCT
GGAAGGagcgcggcagcaggaacttgacgtacgacgagcgccgcgccaTGCTCGACTTCCTCATGAAGAGGCGCATCGAAGGCACCACGAAGCTGGTGCG
CCACGCGGTCACGGACGCAGCCGCCGAGTTCGGCGTGGACCGTCGCACCGTCTCGAGGCTCTGGAAGCGCGCGGTGCAGAGCTTGGAGAAGGGCGACGAG
GTGTGCGACGTGGCGTCGCGGAAGGTCGGGCGCCGCGGCCGGCGGAAGCGCGACTGGtccgcggagctggagcgcgtcaagGAGATCCCATTGGCCCAAC
GAGGCTCCAtccgcgcgctggccacggcggTCGGCATCCCCAAGACGACGTTGTACGAGCTGTTGAAGGAGGACGGGAGTCCGTCCATCAACTCGATCAA
GCCGTCGCTCACAGACAAGAACAAGATCGAGCGGCTCCGATATTGCGCGGATAAAGTGCGACCTAATGGGCTGTTTGACGATATGCACAACGTCGTGCAC
ATCAACATGAAGTGGTTCTCGCTGCCGAGAGATAAAAAGACCAAGGTCATGTtcatggcggcggtggcgcgtCCGCAGTGGGACCCGCAGAAGAACGCGT
ACTTTGACGGCAAGATTGGCACGTGGCCGTTTGTGCGAGAAGAGACGCAGGTGCAGATGCAGGATGCAGACATGAAGCCCCCGCAACAAGTTCCAGAGCG
GGGGGttgtggcgctggaggctgtGACGAAAGAGGACGTGCAGCGCATGATCACGGAGCTGATTGTCCCGGCAATTCGGCATAGGACCCCGGTGTATCTC
ATGCAAGGACCTATCTACATCCAGCAAGACAGCGCCAAGATTCGATGTTCTGGCGATGTAATGTTTGCTGAAGAAGGGCGAAAGGAGGGCTGGAATATCC
AGATGCAGAGCCTCCCGCCGTACTCCCCAGACTTCACTGTGATGGACACCTCCCTCTTCAAGTCCGTGCAGACAGCATTGAAAACATCGCCACCTCCTTC
GCTCAGCGAGTCGGTATCAGGACTCGCGGAACTGGTGTCTGGTGTGGAGCGCGCGTTCGCATCGCTGACGAGCGACCAAATTAACGATGCGTTCTTGTCG
TTGCAGAAGGCTATGGAATGCACAATGCGAGTTCAAGGCTCCAACACGTACGAGCTAGGCCCCACTggcaaggagcagctccagtttcAGGGAAGTCTGC
CCGTGAGCATATTGTGCGACCCCGACGCGATGTTTGCGTGCAGAGCGGTGCTCGATGAGGTCACCGAGGACGCTCTCGAAACTCTCTAAAAGACACGAAT
TCTGGTGTGCACGCATGGAGAACATGTTCTCTTTTTACTGTACGAAGGACGAATGCTAAGTCGAATCCATGTATTTTATTGGCATGTTGCTGTCCTCTTG
CTTGAAGAACCTGCAACTCCTAAGCAGTGATACCAGAGGTCCATTTGAAGCTCTGGTATCACTGGAGTAGCTACTCCTGTTCGTACGAAATGCAGAACAC
AAGGAATATCTTGCGCTACCATCTTAAGCGACGAAAGAAGCACCAAGGTTCCATGCGATGAAGGCAAACACCTCGGACGTTTCCTCGATGATCTTCGTGG
TGGGTTTGCCAGCACCGTGGCCGGACTTCGTATCGATGCGGATGAGCAGAGGGTTCGTCTGCGCCTCCGAGTTtccgagctggtgctgcagctccgcaaT
GAGCTTGTACGAGTGCAGAGGCACAACACGATCGTCGTGGTCACCCGTAGTCAGAAGCACCGACGGGAAGCCGCCACGCTCTGCGAGCTTCTGCATGATG
GGACTATCCGCGTGGGGCACATTGTGCACCGGCGAGTAGCGACGAATGTAGTGGAAGTCATCAGCCACGTCCGGGTCACCGTAGTCCGTGCGCCATGCAT
GGCCAATTGTGAACTTATGGAAGCGAAGCATGTCCATAACGCCCACAGCGCCCACAACGCAGCGGTAGAGATCGGGGCGCTGGTTGCTGGTagccgccac
cagcaggcCACCATTAGATCCACCGTGGATAGCGATCTTCTCCGGGTTCGTGTAGCCTTCCTTGGTAAGGTACTCGGCCGCGCCGTGGAAGTCATCGAAT
ACAttctgcttcttgtgcagcATGCCATCTTGGTGCCATTGCTCGCCAAAttctcctccgccgcgcAAGTTAGGCAGCGCCAGCATACCATTGAAGTGCT
GGACGAACACAAGTCGCGAGACGCTAAAAGCTGGCGTGAGAGAGATGTTGAATCCGCCGTAGCCGTACAGGTACACGGGCAGTTCACCGTTCTTGGGCGC
ATTCTTACGCTTCACAAGGAACATCGGAATCTTCGTGCCGTCCTTGGACGGGTAGAACACTTGCTCCGCCTCAAACTGACTCGGGTCAAAGCCCTTCACC
TTGGTCTCACGGAAGATCTCAGCATCAGGCGCTGTTCCAGGGGTTGCAGGCTGCTTGGACAGGTCAATGCGGAATATAGACCCTGGGTACAGGAACGAGA
TGAAGTGGTAAAACAGCTCGGACTCGGTGCGCTTGCTGGCCACACCCACAGTGCCCACACTGGGCAGTGGGATCTCGTACTGGAACACACCGTCGAGGTT
GTACACGTGCAGTTCGTTGTGCACGTCCTTGACAAGTTGCACGACCAGCAGATTCGGCGCCACAGGGTGCACGCCTTCGATCACGATGGCGTCCGGCTGC
TCGGGGACCACCTCTTCCCACACAGGCGCAGCACTTCCATTGCCGAGCTTGGTGCGCACCACACGCTCACGAGGAGCATCGGCGTTGGTCTTGAAATAAT
AATAGTCGCCGTCGTTCAGGATGTACGAGTATGCCGCGTCCATGTTGTCAACAAGCTTCGCCACCGAGATGATCGAGTCGCTCGGCCCCTTCAAGAAGTT
CTCAAAGTCGCTCAGGTCCGCGACGTGGATCATGTTGGCGTTCTTGCACCCATCCTGCACGTACAGCAGAAGCTTCTTCCCGTCGTCCGAGACCTCCGCG
CCGACGTTGAACGTCGGTTCAGTCGGGTACGTGTACACCAGCTTGTCCTCCGCCTGCGCGGTGTGCAGCTTGTGGTACCAGAGCTGGTGGTTCATGTTGG
CGTCCGTTTCGGTGCCTCTCTTGGGtccctcttcgtcgtcgtgcttgtcgtccttcatcttgtcgGGCGGCGGGTAGCGCGAGTAGAAGAAGCCCTTGTC
GTCGTGCGTCCAGGAGATGCCGGAGAACTTGACCCACTCCACCGTATCGTCCAGGatcttgttgttgtcgtgCACCGCCATGACCTTGATGGTCTGCCAG
TCCGAGCCGCCGCGCGAGATGCCGtgcgcgaagaagagcttgccGTCCTGGAGCTTGGCCTCCGAGAAGGCGCGACTGGAGAGCGCGGCCGTGCCGTCGG
TCGCCAGCAGGTtggggtccagcagcacgcgcggctcgccgtgcagctcgtcctggaTGTAGAGCACGCTCTGGTTCTGCAGCCCGTCGTTCTTGGAGAA
GACGTACTTGCCCCCGTGCTTGCGCGGTGCCGAGTACTTCTCGTAGTTGAAGAGCTCCGTCATGCGCGCCTTGGTCTCGGCCACGAACGGCatctgcgcc
agcgcgcgctgtgtCACGTCGTTCTGCTCGGTCACGAACTCGCGCGTCTCGGGCGAGTCCGGGTCCTCCAGCCAGCGGTACGGGtccgccacctgcacgc
cgtgcagcgtctccaccaggTCCCCGCGGCGCACGGCCGGGTACgtcagcttctcggccagcaagcCCGCGGTCTTCATCGCCTTTTTCATCCGCAGATC
TTGATGTGAAGGGGGACGTTCTTGAAGAAGGACGTCACTATATTTAGTGACACAGTACGTCAAGGGAACTTGACATTTGTATTGTAGTTAGGGCTAGGTC
GAAACAATCACTCTATATGGCATGAGCCAACAACGCGCGCCAAAGCTCAAACAATGTGGAACCaggcgctgcggcgcgtcgtgcacgccgaggagcagca
gcaggcggagcGACGTCGGCAGCAGCTAGCGCGGGCTGCTTCTGCGGCGTCCTGCGCGTCGAGTGCCGCTACTCCGAGCTCTGACGCCCCCGTAGAAGCC
GCGCAATccgcagcagaaggcgaGACCCCCCCGACAGCTGCGGACCCTGCCgcttccgccgccgccaacgtTGAGAACAAGGCGCAAGAGCCCAAGAATG
ACGCGGCGCACgtggaagaagtcgaagacgacaacgacTACCTGCAGAAGCACCTGCTGTCGCGCCCGACGTCGGCCTGGAGCTGCCTCGAGGACACGCA
GCAGGCCAACTGCCTGGCGCTCAACGCCTCGCAGACGCTCATGGCGGTGGGTGAGCGCGATGGCCGCGTGACCATCTGGGACAACACGAGCATCCGCGTG
AtcacgcgcgagctggacccgACACTCATCGCGCTGCCGGCGGTGGAGTCTCCCACCGGCGACAAGGCCAAGGGACAAGATGGCTCCACTGCCAAGACGG
ACGATGGAGCGAAGAAAACCAAGGCAGACGCAGCTGATGCAGAGGGATCCGTGGAGAATGACGACGCATCAGTggaagaggatgaagaggagagGACTGA
AGACGCGGCgtcggtggaggaggactTGGCgacggaagaagacgatgaggCTGAAGCTGAGGGGGACAAAAACGCTCACGACGAGAGTGAAgaggccaag
acggaggacgaAACAGACACCTCAGGAGGCGGAGCTGTATTGACGTTGTCGGATCTTCGGGTGGTGAAGACAGCGCTGAAGGTGGTCTCGCAGTGCGCTT
GGTCGTGTGATTCGCGATGGCTTTTCGCCGGCTGCGAGGAGAAGTCGACGCGTCGGGCTCGGCTTTGTGTGTGGAACGTTGCGGCAGCAACGCTCGTTTC
GGCGTTCAGATTTGACGGTACGATCACTGCCTTGAGCGCACACCCTCGTGACCCGAAGATGGTAGTCGTGAGCTTTTGGAACTCTCGcccgatgctgctg
gatgtcgtCTCGGGTGAACGCACAGAGCTGGAAAGTGTTCCGCTGGAAAACTCGGATGTCGCCCAACCAACGCCACAAAGTAACTCGCGGCATCCCGTCC
TTGCATCCTGCGCACGATACGGACGTTCTGGGAAACGCATCTACTGCGCCACATCGAAATCAACGCTTGCAATACTGGACGCTGCAACACTGCAGTGTCT
TGACAGCCTCAAGCTGAATGTGATCATCCAATTCGTCGATCTGTGTGTGAACTTGCGTGAAACAGCAATGCTACTCACGAGCTCGAAGGGGATTCATGAG
TTTGTTATGGACTCCGCTACAGAACCTGTGGCGTCAAAGGAAGGCTCAGTCAAAGTGTCTGTTGCCGTGACAGGGGGTCATTCAGTGGGGCTGCGCGAAG
TGGCACTACACTCGACTGGTGCAGTGCGCGCACCTTGGGCAGTTTGTTGTTTCAGCGGCGGGGAGGAGTTCGTAGTCGGCACACCAGTTGTGCGCCACCG
GCACGTAGGTGAGAACGGCTTGTTCACGTGGCATCGCGCTTCCGCTCTAGGAAAGACAACGGCTCAGCACAATGCCGGGGTGAAAGATGGTGTGCTCGCT
CTAGCTTGGGATCGCTCAAGACAAAGCGTGTTAGCTGTCTCTACAAGTGGGGCTTTGCACGTGCTTGAGGAGCAATTTACCACAACGTGGCCAGGGGCAA
TGTATCCTGCGGGCTTTCGTCTGATCACCGACAACGAATTGCATCTGGAGGTGTTTGACCATGACGCAGAAGATCGAAAAATTGAGAAGGAGAAACTCAC
CGAAGCTGCAAAGCATGCTCCTGTGGATGTGTTCACTGTGCAGAGCCCGACAGAGGGGTTTCCTGGCGAATGCGATCTTGCTGGCGCTTTACTCCCCAAG
AATGAATTTGATAAGCCGTGCTATATCCCAGCTATCCCGATCGCATACTACCACCGGCGGCATCTCCACCTACTCCACGGATCGCCGTACAACGAAGACA
AACACTTTGGTCTTGGTCAAAGCATTTTTGAGCCACTTAAGGGTGCGCTGGGTAAGCAAAAGAAGAGCAACTCTCGGAAATCCAAGagcagtggcggcag
caaTAGGAACCAGAAACGGCGGCGCAGATAAACACCCAGCGATTCACTCCTCCAATACCACGCGTTTGCCGCTGAACGAGGACAGGTATATCATGAACTG
ACGTGAAGTACCTTGCAAGTTATATCTCCTCTTGCTGTACAGAAGGTGTTCGTTTATGCTCCAGGGCTGCCTCGAGCCGTTGAAGTGATTGCGTCAGCGC
ACAGCTGCGTAAGGCATCATGCTTGCTGGTTTTGAACGAAGGAGCTCTCGAGTTCGtgtgctgctcttcttgagtGCCTGTATCGGGGCTAGCCGAGTCA
TCGGATTGGAGACGCTCAACCATGGGGATTCGAGATATCTGCAGCGCTCGAAGAGCTATCGAATCGACTTGTAAACGTCGATGTGCGGGCGTTCTGGGCG
GACTGGTTGGACTAACTGGGCTTATGGTGAATGGGAGTTGTTGAGCAGGGGTTGCATCGACGGATTCGGAGCGTTCAGAGCGACTTGGGCATTCGGACCT
TCGTGCCAGCTGCCTTGCTGCTCGGCTACCTTCCCCCGACCGCCTTCCTCTTTTATCTAGCTGGGCCATCGGTAAAGTTGCGGATTCGCTGACAGGGATG
TCCACGCGCACACACGCCAACGATGTGGATACGTGCCCTGCCCAACCGCAGCGAGAGCACGTCAATTTACTGCGTCGCTGAGCCGCCAGCGTCAGCCGTA
CAACGTGTTCGGAGCCTTCAGCTGTGAATATTTTGCGTTGGGCCAACGCTGTGGCCCTCCTCAATTCATACCAGGACTGTCGGTGAGCGATCCATTCGTG
AatcagcttcagcgtcgatGGTTCTTGTGCCAGTACCATGAGCAACACCGTCGAGGGCAACGCGTAGGCTCGTGCTCCGTTCGCTGATGTCACTGCACAG
TATCTCTCAAACGATGTAGCCAAGCGTAACACCTCCACCAGTCCAACCGAATCGTGAGCCTGaaggagctccagctccagatcGACTTCTTTTCTCACTC
CAGGGCGTTCTTCGCGAGGATCTCCGAGGGTGAGCTGTCCGGTGATCACGATGAAGACTCGCGCAGGCTGACCAGGGGTGAAGAGGTACTCTTGCTGCGC
TATCACAACGGGTTTCAGATGCGCTGCTAGGAATCGTCGTGACGAGTCTGCCATGGTTCGAAAGAGGACGGTGTTGCGCAGAAACACCTCAGCTTCTGGT
GCAAAGGAGTACGGGAAAGATGGTGGCAATCGAGCGCTGTCATCatgatggcggcgctgcaggagctggagctgctggatggccTGGTATGGCAAGCACA
AGACGTAGGTAAGGGACACCTCGCGCAGACCAAGGAAATTGCGCTGTCGTGCACTGCCTGCCGTCGCAGTGGATAGGGTGTATCCAAATCCGaacgctgc
agcatcaagGCCGAAGCAATCACCCGCTGCAAGCTCTCGTAAGTGGATGATAGGACGATCACTGCGTCCAAGCACTCCAGCGGGCATCCTTGGTAgagtt
gctggtgctgacggtgTCTTGCCAAAATCTCGTACAAGTACCGGTCGGAACGAGAGCTCACAGTGTCCGTTGAGAAGGAAGTACACGCTCTCGGTACGTG
TGATACCCTGGATCGCGATCGTCTCGCCTGGCGTTGCTGACAGCACGGTCGTGTACCGGAACATGAGTCTCCAGGCCTCTTCACAATCACCAGCTTCCTC
AACGCTGTCGATTTCCTCCCGTTCTTCGGTTTCATCAAAGCCGTCGCTGCACTGGTTGGCAGCTGGCTCGTCCTGCGCAAGGCTGTCCGTCAGATCCTCC
TTGTGCACTTTCGCCGTCTTTGCGTTGATCATACGCAGAGCTCGGAACGTACGCAGGAGCTGTGGGAAATGCTGCGACAACCACTGCCGGAACTCCGCCA
CTGCTCTCGGATCTTGTCGTCGGTTGCTACTTGCCTCCgggttctgcagcagcagcttgaagctctcAGAGCCGCTGAAAGGGTCAAACGCTACGGACTC
GAGCACCACGCGGCCTCGATACGGAGAGCTAGCTCCAGCGAGCGACCCCCGTGGTCTAACAGGTGACACGGCATTGAAGCCCTCTCGCTCTGTACTGCCT
GGCGAAGAGGGCGAGGAAGTGGCTCGAGGTCGCGGTAGTAGCACAGGTGCCAGCTCGTGCGTCCTCAAGCTATATCTACCCGACGCCATGGCCGTTGGGG
CATCTTCCGACATGCTGACAACGTGCAGGACGTAGAGTGAGTGCTCCCACGTGGTGTGGACTCTAGGGCAAACAAGAGCTTTACCCTCTTTACCCTCTTT
TCAGCCTTGTGCTACAGTAGCTATAAATACGGAAGGTGATCTTGGTGCGTGAATTTCATATTTTATTCGTGTGGCTTTGGCCGAAGCCGGGGCCACTTGG
CACTGCTTAAAGCGTCTCTCTCATGCTGCGAGTATAGACACAGGCCTCGGGGACGTGGAGCGTGGAGTTtacttcttgccgcccttcttgccgcccttct
tgccggccttctcctccttgggAGCTGTGCACACGACAACGAGTCAGATACAGCACTCAACGATGCATGGCAGCAGGGCACCCAGAACTCACCGTCCTTG
GCGGcggtcttctcctccttcgcgtccttgtccttgccCTTGCCCTTGCCCATGACTGTCGGAGTGCTTGGAACTTGCTGGAGAGGAACTTGGTCTGCGA
GCTGGAAATTCGGGAATGAGAGCTAAGCTTTAGCGCCGTCGGCCCGACCGTGAGCAGGCGGGCGGTGTCGTGCCGACCGCTGGAAGGCCGGCCGTTATCA
GCTCCGCGTAACGGCCAAAGTGACTTGGTTTCTGTATGGCGCGGCGATCTCGAAGCGTcgcatgttgaagttgactcGTTCGGGGGCGCGACGTGGCCGG
TCGGGGACGAAAATTGTGGCGCTAGCCACCTCGCGCGATCCAGGACAACTCCCCGTTGCTCATTCGAAGCTGGCGGCCTCCTTCGCGCTGGCTgtggcga
tgaagacgatgcaGATTCCTTACCCATGGGGGGGTCCATGTTGGGCCGCGCTCTGCATTGAGAACATTTTAAGGTGCAACAAGCTACACGCCACTAGAGT
GCGAGGTTGTTGAGCGCTTCCGCAAGAGTTTGCGCGGCCTGCTGACTGCTCGCGTCCAGCcgaaggccagcgccgcgcttgCAGAGGCCCTGCATGAACT
CGACCACGtacgcgcgcgtgctgtcgAAGTAGCGGCAGGTCCACGTGTCCATCTGCATCTGCCTGGTCAACGTCTCTCGGGGATGGGGCTGCTTCAGCGA
CCGCGCTTTCTCGTGGCTGTACGCCATGCACTTGCGGACCAACGCGACGCCAGTTCGTGGCTTCTTGTGGCGGCGACTGCCACTTCGACCGGCAGCTTCC
TCTGAATCTGCGGCGGTGAGAGCTCCTCCCAGTCGAGActcgtcgtactcgagcACGGGGACCACGAGGTTGACAAAGTCCAGCATGAGTTCCGTTTGCG
CTGCCACGACTcgctcagcgtcgtcatcgccctCGCTTACGTCGCCCAAAGCCTCAATTTCtcgcgccacctcctccaccgtcgagctgaagcgcgTCTG
CACTTGGTTAGagaacgcgtcgtcgccgccgtaCAGCACGTCGTTCGAGTCCACACCTTCCAGACGGCCTGGGAGTGACCTCTGTCCCCATAGAGCATAC
AGCTGGACGAGCATGAGTAGCACGCGCACACGGGCGACACCGGCTTCGAGACGGTgtgacagcgaggacgagctcggTGACACCCACAccatgcgctcca
gcacagATTTGCACAGCGCAGTTACAAAGTAGAacgcgtcttcgtcgttgaGCGATGGCGCATACACCAGCACGCTCAGTAACTGAGCTATCACTTGCAC
GACTTGGTCGATGCCATTGCTGGCGCCGTTGATGGCCACTGCCCCAAAGAGGCCGACAGCGACAGAGCGGCTTGGCGTGTGGAAAGCCACCGCATCCGAA
TGTTCGTCGGCACGACAGGCGCTTGGGTCAAGatctgcgagcagcacgatTGCAGCTTTCACCAGTGCGTCCATCTGCGGGATGCAGCTCGTCACCAGCG
CGACATTCGCTGCAGACAccatgagctgcagcttttcaAGCGGAGCCTCAATCGACGGAATCGTGATATGCGCGAACGCCAAGCACGACTGAATGAAGTT
CCGTCGCGCATGAGCTCGCTTCTTGCCCCCGATCACAGACGCTACGCCGCCGCCAATACGTTTGTGCACGTGCATCGCTAGCCGAAGTACCatcgtggac
agcagcatcttgatCGGCTCCAGCTTATAGAACGCACGACGGCAATCTGTGTAGAGCATTAGCAGTGCCTCCTGTTCCTCGTCCTGGGCGCGTTCACTCG
CAGTCTCATTTACGTATCCGAGTCGCGTGATGAATGCCGATATATCGCGATTAGCCTCAGCGCGCTCGGACGTCGTACTCAAAGAGTCAAGCGCGTCATG
CACCCGGCAACAAACAACCAAAAGTGTGTGCGCCACCGCAGCTTCGGGTCCAACGACGCGGAGCCGTAAGGTGCCAGACCGGTTGGAGGGATTCTTCATG
CTCCCTCCAACAAATGCTCGTAACACTTTCTTCGCTACATCCACACTGGACTCTCGCTTGAACATGCCCATGAGAGCCTGCATACAGAACGAGTTCCAAG
TTAACACCAGAAGGCTACGCAGGGTGTTACGTGCTGCAAGTTAACCAGGTACTCACCAAGAAAGACGCAGACGGGATGAGCTTCGAGAAAAAAtcgtact
gctgcttggcgccaAAGACGATATTTTCAATCAGAGCACCGAGCAGGTTGTACGTTTTTGCCGTGAGCTCCTCTGACGTTGCTGCATTCAGGTGGCGAAC
AACATCCTTCAGTAGGATGAGGGCCTCTCGATGCTGTTGCCATGCAAAAAACGAGCACTACATTAGCGGAAAACCGAAGTGCTCCCTCGAAACACCACTA
CACATCGTACCGAGAAGTGAGCAACAATAAGCTTCATgtaagctgctgcgctctcCATATACTGCGTGATATCTTCTTGAGAAGTGATGGACGACCAGGA
TTCGTTCAAAAACTGCAGCTTTCCACCGGGTTCATTCTCCGCAACAACGGGCACTTTGCTGAGCTGCACAGCCACAAGGCTGTAAAGATGACACTTGGAA
ACAagagacggagacgctgtACGAATCAGATCCAACATTTCGCTGGGCGTCGAGGCGTAAAACTGGGCACCAAAACACTCGCACAAGTGCTTCAGCACCA
TGGAGCTGTCAGAGTACTCTTGGTAGTGCGCCAACAGCGTATCAAACGTGTCCTGCGTggcacctggagctgcacacCTAATGAGCCACTCCACGGCAGG
TGAATGCAGCGCCAGGTAATCATCGTGTTCCATTTTGTGAGTGAGCAACCAGTGCTCAAGCTTGTTCTGGCGGAACCAGTTGAACGCGTAAAAGTAGTCG
AACAGACTGCTGCTcaccacgagcgtctgcTCTGCCGGCGAGGTAGTACCCAGCAGGTCTGAACTCGTTAATGCCAGGTACAGACGTGCGTATAACGCAA
CCATTGGTTCCCCAACTCCTCTAAAAAATCATTGGCAAGGAATAGACACATAACGCAGCGTTAGAAGCATATTTCGTGGCAAGCTTCGCAATGCTATACA
AagtcggcagcagcagattaCGTACTTGATCATGTTTGATAGTCGTGCTACAATCTGGGGATATTCTCCATCACAAAGAAAGCGGTAACACCCGAGCAAT
GCAACCTCGATGTAACTGAGCATAACAAGTGGCACACTCATTAGACAACGAGCAGCGATAAACGACCTTAGCATAATGTTTTGGCACGTACATCCGTGGC
AGAAGCTCTCGGATGCAAGCCGTCTTGTAAAACCAGTTGCGGCACGTTTCGGTGGCTTGGGTGTTGACGTCGGAGCTCATAAAATGCTCGCCAAGCGGCT
CTGGAAGAGGTTGGCCACTTTCATCCTCGGACGCTCGAGCATGAATACGGTCAAATACCAGCTTTCCAAAGACATCCAGCACTTCGCTTACCAGCACAAA
CACGCAAGGGTACAGTTGAGGAGCCGTATCGGAGtctgcgagcagcttcacgcaCTTAATCGCAATCCGTAGCGCCTCCACTTTGTGGTTTTGCTCCCAA
CTCGCGGTCAGTCTCCTCTgcatctccttcaccttggccacATACTGACTTTGCGAGATCTCAATCGTTTGCTCGTCTTgctcggacgaggacacaGTCG
TATCCGggctgcgctccagctgctccagtcgAGCGCGACTTTTCTTGATCACTGACGCCTCTGCAGGGTCGTCTGCCTTTTGGTAGTCGCTCTTCGGAGC
GAACGAGATTTCGTTCTCCAGGTCGTTCACTTCGAGCATGCTCGCTTTGATCTTGAACGTGTGGTccgcgtacttggccagcagccgGTCCGTGTGCTCC
TTCCATGCGTATTTGACCGTATTgggcgttgcagcagcttgctccGATCTCTTGTTCCGCTGCACCGCGTCAATTGACGTCGGATTCGAGTGTGCAGGCT
CCAATTCTGCCGTTTTCCCGTCTCCTGAAGACCCCAGCACGCCCAAGGGGTCCACGTCCCCATcttgcagcaccacgagctctgGAGACACTCCGGCACC
GCTCCTCCGCTTGGAGAACGAGTCCCCAAGAGCGGGAGGCGCAGAACTGAGCGGAGGGGCCACTGCAGTCTTGGAATCCGCTGGATCTGGCGCTTCCAGA
CTGGAAAAAATCGATGCTAGAGCCAGCGGATGCGTCTCCTTGGCTGTTAACCCGCGTGGCGCCAGGTCGTGACGTGATCGAAGCATCGGACGCTCCCCCA
CGCGCCACTTGATCACTGGAGCCGCCACCGGAGACTCTcgctccatcgccgccatcgtcatcgaggagctcttcgctCGCTAGTTTGAAGCTGCCATGCG
AGATCCGTTCGTACTTAACCGGACACAGCATGCTGATTTGGCGATAATCACTTTATTTACCACCAATAACATAACCGTATTCCAGTGTTCGAGTGCGCGC
CAAGCATCTGGAGGTTGAGCGGAAGGAGACCACGCCGTAGCGACCGTGTGGAAGCCGCCCCCCGCGCCGCAGGCAGGTAATACGCACACTACTGTTAGTA
TAGTCGTCCACTGGAGATTCAGGTGCATGCAACGAGGCGGTTCACGCCCTCTACTTCGCTCTGGAAGCCGAGATATCCCGCGTCAGAACTGACTCCGTCC
ATGATGTCACCGCGTGCTGCAATCTTTCAGGAACATTTTATATAGACTCAAGCTAGAGGATGTTCGGAGCGACTGCAGGAGCGACGCAGCCCGCGGCcgg
cggcttcaacttcggcGGAGGCGCGCCAGccccggcggcggcaccgggcggcttcagcttcggaGGAGCGGCGACGTCTGCGGCTCCAGCGGCCTCCGCC
GGGTTCTCCTTTGGTGCAACgcccgcggcggcgcctgccGCTGCCAGCGGTGGCTTCAGCTTCGGAGGCGCCAGTGCAGCTCCGGCTGCTTGCAGCGGCG
GCTTTAGTTTTGGCGgaacttctgctgctcctgctgctgcctcgggCGGATTCAGCTTTGGTGGAACAAGTGCGGCCCCCGCTGCTGGTAGCACgggctt
cggcttcggcggcaCTGCGCCAGCTACTtgcacggcgtcgtcttTTGGATTTGGTGGCGCTACGGCTGCGAAGCCTTCTCTCTTCGGCCAGACTCCTGCG
GCGACTAGCACCACGGCGACGGGTTTTGGCTTTGGAGCCAAGCCTGCGACTACAGGCACTGGCTTCGGATTTGGCACAGGCGCTGCCACTGGCACGAGCG
CTTTTGGAACGACTGGTACTGCAGGATCGTCGCTgtttggtggtggtggcggttTTGGCACCACCACGCCTGGAACAGCGCCGTCGGCCTttggtgcagc
tcctgcagcttcgaccGCGCCAGCTCCGATCATCCTTGGCGCAGATGCCTCTGTTGCGCAGCTTAACACAGTCAAGGCAGCATACCAGGATCCGGCGCAG
TCACGCTTCAAGTTCCTCATGTACAACACTGTCGACCCGACGCAGCGGCACCTGTACACCCGACCACCACACATTAGCGAGCGCCTGTGGAATCAAGCCG
AGCTGGATAACCCGGACCCGCTGAACTGCGCGCCCGTTCCTATCCTGGGCTTCGACAATCTGCTCAAGCGTatcaaggcgcagcaggagcacgcTGAGAA
GTACAACAAGTACACGGACGACCTGCGTGCGCAGCTCAACGAAATGGACAAACACACGCGTGCCACagaggagaagctggagaagtgccgccacgagcac
gtgcagctcttccacgCGCTGGTGAAGGTCATGCGGgacatcgagctgctgcagaactaCGGCAAGCCGCTTCAGCGCGAGGAGATGCAACTTGCGTACG
CTGCTGTCAGTCAGGCATCTTCGTACGTCACTTGAGACTAACTTGGCATGTTTTTTTGTCGCGTGGTTTGCAGGATGGcgttgaagaagctccagACGTT
GCTGGACTCGCCCGGTCAGTACAAGGCACGATTAAATGACGCTGTGTcactgcagcgcgttcagaaggaggcgctgcctCCTCCGACGAGCCAGCTCAGT
CCGCAGGACTTGCAGCGACTCTATGAGGTGCGTATTGGAACAAAGCGCTCTCTGGTTTGCAGGTTGGATAGTCTGACGATTGCTTGCGTATTTATTGTGT
GCGTCTTGCAGTTCATCGACAAGCAGCGGCAGGGACTCGAGCACCTGACCAACATCATTAACGATGACCTCGCGGACATGCAGCTCATCAAAGAAACCTG
GCGGCGGTAGGCGGACAGCATTCGTCCGGATCACACTGTAGCAGCAACAGTAGCAGCTAGCTGGCACCGCAAGTGCCTCATCGATTACCTCATGGTGCGG
CGTtgagcaagtgcagcgacTGAAGAGAAGAAGTATTTCCCTGTGTCGTTTCTGGTCTCCTTCTGCAATTCTGCAGCCTCACGggacaggaagaagaagg
cgacaaGGCACCGGAGACAGCAGCTGACACGCATGTTCGCAAAAAGTTACCAAATTGTGTTGTCTTTGTTTGTTTTCCCCTGAATTTGGAGCCGCCTCAC
GCAAACCGTGCCGAGTCGGCCGACTGGCTGCACTGCTGCGCTCGGTTTTCATACTTATGCATGCCAAACACAGGCGCAGTTACAGTAGTGCGGACAGGGC
CTCAAGACGACGTCCTCGAGTAGCTGCTCTAGTGGTACGGGTCCACTTCGCCGTACGTCTCGATGACCAGCGGGGTCTCGTCGAACTGGTGAATAGGAGG
GGGCGACGACAGGCACCATTCGAGAGTCTGGTGCACCTCCGGGATCACGACCTGGGCGTCCTCCGTGGGCGTGTTGTGCACGGGCACTCCGTGCACCTTG
CCGTCCGTGGAGAACCGGGCGACCGCGGGGTGGATGGCGGCCGTGGTGTTGACTGCAGAGAGGGAGGGAGGGCCAACACGTGAGTCAAACTGCGAGAACT
CGGCCATTCCGACTCGGATTCGTGCGGGATGAGCGCGCACAGTCAGCGGATGCAGAGGGGGGACACCTACCGGCCTTCAGGGCACGCATGGACTGGCGGA
TGAGGCTCATTCTGGTGAGTAAGGGGCTTCCCGGGGGTTTCTTGATCCGGAAGGAGCTCTTTGAGGActgcggtggtggtggcgacaAACCCCCGACGCA
AAGACAAGAGACTTTGTGCGGAGGAGGGGCCGTCCCTTAAGTCGCAACGCCGTATGGTTTTGTATGGGGATTTATATGTATATATATATGCTGGTGGTCC
TTCCACCCCTGATTGGGCAACTGGCCGTACGTCCGgggacagcagcgaggtCGGTGGCGTGAAGAGATCTGCGCCACCGAAACCTACCACAGCTTGGTCT
TCGCGACTCGCAAGTTGCGAGTGCCGCAGCAAATTGGAAAATGAGGCGGAgagggcggcggcaggtTTCCTTGTCGCCGGCGGAAAGCCCCATCCGCTGC
TTCGCCGCGGCTAAAaacgctgcggctgcgatTGTTGAATGGTGTAGCGGAGCATGCGAGCTGTGCAACACTGTCAGTCTGCTTTCCGCTGCGCTGGGAG
GAACGATATACAGTAGCTACACTCGACAGTTTATTGTAAAATGCGCTGTTCGTCACTTTAGCTTTGTCGGGGTGAGTCTCGATGTAGCATTTGTCACCGC
AGTGGAAGTTGGTGTCACGCCTTCGCTTGGATGTTCTGCCGTCACGCTCGCCACTATAATATCATTCGTTGCGTCTCACAtccagcgaagacgaagtACA
GTGGCAGCAATCTAGGTCTCGGGTCTCCGTCGCAACGCACAAGGCATCACTCCGAGCGCCATTAGGCATTCTAAAGGAATGCACACGCTTGGAGGTGAAG
TAAAGATGCAGGGTTTTAGCAGAGCCCCGGCAGAACATTTCGTTTAGAGCTCTtatcgctgcagctctccCACCTCACAAGATGACCCAGTCTCCTGCAA
CCAGTATGCCGCTGAGCTGACAAAACTGTTTGATACCCGGGAAGGCAGTGTAGGAGTCAAACGCACTCCGCTATGTACGTGCAGATAACGTAGTCCTGCA
ATGCAGCTTGACCCAGTTTCCTGATCGGTTGCCATGTTCGAAAGCTCTGCCACCTTCAAACGATGAAACTGGGCGCGGGACGATCCTAACGACGACAGCC
CCGTCGACTGCAGTTGATGAACCACTACACCGTGTGCTTCCCGACATTTTCGGAGCGTTCTGATTGACGGAAATGCATGTGCTCCAATCCGAATTCGCCA
GCTGCGCCTGTTTCCGCCAATCCGATGGCGTCCTCCCCCAAAACACCTCGCGGTTTCGAACGAGGTTTTCCCGTATTTTGTCGAATGGGGCCAGGGTGCC
GCGCTTCTCCACTCATTATTGGATTTAAATCCGCACGGCGCCCAACGACAGGAAGAAATCCCCCTTCCTCCCAGCTCTACCTTCGAGCAGGTGCACCGGA
ACGCGATGACGCCGCcctcggacgacggcaaggcGGACGGCACGCccaagagcggcggcgacctggcgcagcagcagcagcaggcgctcctccagcagca
gctccagcagcagcagctgcagctcctccagctccagcagcagcagctccagagcCTGGCCAGCCAGAACATGAGCCCCAccgagctcgcggcgctgcag
cagcagcagctggcgctctTCATGATGCCCATGTTCCCGCTCATGGTaccgctgcagcatcaggcgctggcggcggcctccgcGGCCACGGACACCTCCG
CGTTAGCCACCGCGACGTCCGAagtggccgccgcgccgtccgccgACACTGCGACGACGTCTGAGGAggctgcggccgccgcggccgaggccgaagctgc
tgcgtcgacttcgacgcccggcggcgacgcgtcgCCTACGTATCAGCCTGCGACTGCCGAGTCTCTTGGACTCACGCCGCCTTTTGTGGGCACCGACGGA
TTCGGAATGCTGGCTGGCGCGCCCGGTGCCCCGCTGAACATCGAGGAAGTgcccaagcgcaagcgcggccGGCCGCCCAAAAaggacgtggcggcgcgGG
CCAAGGCGGaagcggagaagacgctcaagcagcagttccCCATGTGGGGGTACGGTTTGCCCATGCCGCTGTTGCCGGGCTTCCCGGGCATGCTGCCTGG
CATGTCGAACCCTGGTGCCGTCGTCAAGGACCACGCCGCTTCGGACGATCAgacggtgaaggaggaggatgGAGACGGCGAGCGCCCCGccaagatggcc
aagaagaagcagcgcggaaCAGGCAAGCCTCGGGGCCGACCTCGCACGCGCCCTCGCCCCGGCGAGATCATTCGCCGGGTAAAGCCGCTGCCTATTGCGC
CCGCAAACTATTCGGTTATGTACAACTATTCTCTCTCCAACCTGGCGCAGAAGAGCGCGGAGCTTAACGCCGACGGATCTACGGCAGATGCGGAAACCAC
GACGGTCACTGAAGAAACACAGGATGAGAACCGACTGGCGCCGCTgagcgcgtcgctgctgtctggGGAGCACGAGTAAGATCCGGCAGCGACCGCTTCA
TCCATCTGATAATTCGCAGTCGACCAGTAGCGACTGCTTTAACATGTTCATGTTCACCGTGTTTCGAGTTGGTGTCCCCCACGCGTCCGTAGAAACTGAC
TGGATGCGTAGTTTGCTGTGTGTATTTGAACTATGTGGGAGGGTGTCTATGTGGTGTAGCTTGGGCGCAGGCAGCGAATGGGCAAGCACGCTTTGCGATG
GGGTGGGCGAATAAATAaagaagctcgaggcacTCCATTTTCCAGCCGTCTGCGCGTACGGCATGCGTCTTCGACTGGACCCTACGCCACCTgtgctgcg
cgtgggcggctgctgctctagAAGAAAacctcttcgtcgccatcatTGCTCACCGCGTCACTGTCGTAGTAGTCGAAGGTGTAGTCGTTCATGTCGTCGC
CCAAGTCCTCTTCAGCGTCGTCCATGTCTCCGTCATctgcctcctgctcggcctTGTCCGCTGcaatcttcttctcctgcgctTCTAACGACTTGAATAC
ATTCTCAAATGCACGCGGCTGCATGATGCCGCGGCTCGTGgagcccgccgccgccggggTGCGCAGTCCACTGAGCGAgttggcgcgcagctcctcgggc
ACGTAGACCTCGTTGGCCTTCTGCGTCTCCGGCACTGTCACGTGCACAAAAGCTGCCGGATTGGACGCATTGCGTCCAGCGTCCGGGCCTGCTGGGTCCG
TTTCCCACGGGTGGTACAGACTCTCGAGTTTGTGCGCCAAGATGCGCTGTCTCTGGATCAAATAGGCCTCGCGGTCGGCCAGAGCTTCCGGCTGGGGCAG
CGCCATGGGCGGGTACAGTGACGCACCAGCTTCCGCCTGTAGGAACAACAATGGAGAACGATTCATAGTCAGTCACTGCATGGCAATTAGATGGAGACGC
ATGAAAACGGCCATTGACACATACGTGCAGCAGATCCATCTGCGTGTGCGAAAGCCCCAGGTCCTCGCGCGTCTCGTCCATGATGTCCGCCAGCATCGAG
TCTCGGCTGCCGCCGAAGCgcacgcggccgcggccCCGTCCTCGGCTCATAGCGACTGTCGCGCAGGCAAAGCAGGCCGGCGCGCTTGGTAAGATGGCAA
TGGCGTGTGCGCCAGCCAAGGATTCAATCGTAGTCCGAATCGTAGGTTGGGGACTGTGCTATGACATACCTTTGAAGCGACGATATCAAATCTCCGAGGT
CGACGTTTGACCAATGGGAGGCCAGGACGACTGCAGCTTCAATTTGTCCGCGTCGAGTATGCTGATGGATAGAAAGGTAGTGCTGCAGGCAGTCATCCGC
AGGGCCATTGTTGACGCTGGAGTGGCGCCGGCGTTCGATGAAGTGACGTGGAGATCCTTCTCCGACGGGAGAGCTGGGGCCCCCactggggggggggggg
gatctCTCCCTCCTCGCATCATCTTCTCGTGGCAGACGCGAGGTGCGTTGTATCCTAGTCGTTGCAGCTTATTGGCATTGCATTGCTCACATATGCATAT
GTAGCTGCAGGAGAGCGCTTCAATGACTCCAAATGGCTGTTTGGTAGCCTCTAGCGCTGCCGTTTTCCGACTCCAGCGGTGCGGAGACCCGTCTCGGATG
ATCCGCAAGCTACAACTTGACTCGATGAAAGTTTTGCGCGCCATACTGGCGCTCGCTGTAGCGCACTTCGTGTGCCGTTTGGACGAAATTAGGTGGTCGA
GTAGCTCGGGGCCCATCTTTCGCTACGTTGACCCAACCGAAGAAATGCTGCGCAAACAAGACGCGCTTGTGCAGATCGCCAAGGGATCCTGTACGGCACC
ACGCTTTGGAATGGTGATGGCTGAGGCTTCTACAGTTGCATCCGGGGTACCGAAGGATGCCTTTGAGCCAGCAATGCAAGCAAAACGAGTCATAGCGGAG
GGACCGCTCACGCACGACGCTTACCGACACCAATGGTCTCTGCTCCGGATTGCAGCAGACCCCGCTGTCGCTTTGGTAGCTTGTCCCCGTTGCCAGGTTT
CGCCTTCCTCACTTTGGAATTTGCCAGCTACAGCGCATGCATCAACGTCCGACTCCAATCCAGTTTAGCAACCTACTGTGCGATGCGGACATCGGAGGAT
ACCGTCCAGCAATTCGTGAATGCCGTCGCAACAACCGAGCTGACCCCGTTATCGTCAGAGCCCGAGACTGGTCGGACGTACAGCTACGGCGGAATCCTCT
CCGGCTCAGCTGACCCAGCGGTGCTAGAGCTCCCCCAAGGTGTGCGTTGGCTCGGCGACACACCCCTGGCATCGACTGAAGTTGCCCCGTCACGTCTGTA
CGTGCGTCCAGCCtaccaagtgctgctgctcttggccATGGCCTTCCTGGACCACCCCGAGATGCCGCACCACCGGGTAGTAATCACCGGATCCTCgggc
acgggcaagacgagCTTCCTGAACTGGGTGTTGCGGCATTTACGTCGACTGGAGACACCTCCAGCGATCGTGCTGGACATCGCTGGGTTCTTCGGGTGTA
TCGCTTCGGACGGTGAGGTCACTGCTGGCACTCGAGGCTCGAGCTTCCGTCAGGAGCTCGCAGCGCGAAGCACAGTGTATCTGTGCGATGCTACCTGGAC
CGATGACGGCGAATTTCCCAGTGATCCTGAAATCCGAGCCCGTACCATCGCGATGTCCCCACCGACGCACACGGTGGCCACAAAAGACTCATCGGACACG
AGGCGCACGTTGATGCTGGTGATGCCTCTGTGGACCATAGCGGAGCTCGAAACCTGCCGCTCAGCTTGCTACTCGCACAGTGTCTCGCAAGAAACATTCC
TCGAGCTCTACCACCTGTGGGGAGGCGCTGTGCGCTGGACACTAGGGACGCCCAAACAAGAGGCCAAACACGAGTTCGtccgcagcttcgagtcgctcCC
TTTTGCTTCAGTGGTTCAGATCATTCGCAATGGCGGCCTCGTTGGAGGACACGAAACACAGCAGGACGTCGAGATTGAAGTCAATGGTGATATCACGGTC
GGGTCCCGAATCATCCACATGCACGTCGACCCTGACAGCACCTTTCAGCTGCGTGGGGCGGCGATGTGTAGCGCTTTGGCGTGCTCGCTTCTCATCGGTG
CCAGTtccaagcagctccagagcGCTCAGAACTTTGTCGGGAGTAGCGACTGCCTGGCTGAACCGAGAACCATGCAAATCTTCTACCAACAGGTACAGCA
AGAGCTATTCGATAGGGAGTCCAGCACTCTGTGAACAACAATGACCACACATCAGTCGCTCCAGAGATGACCGCATGTTGGCAGCAAATGTGAGCTTTGA
ATGGAAATTCGATGATTACATTACGCTTGAAGCCTCCTTTCGTGTCAACTATTGCGCTTTTAAGTTCCTGCGCACACCTCAAGtccggcagcggcttcag
TAGGAGCCGCCGTCACCTCGGTCGTTACCGTTTTCGCCACAGGAACAGGCAATGGCGTATCTGGCTCGGATGCCGTGAAGGTGTTATTCATGACTCGTCC
CGCGTGCGATCCACCCATGTACGACGGGAGCGATGACAGCGGGATACCGTGATTCTGCGCCACCTCCAAGAATGCCTTCATGTCTTTCTGCGTTCCGGTT
AAAAAGCACGACACACAAGGCTCAGTACAATGCGCCAGCAGCTAACTTCTCAAGATAAATCACGTACAAACACTTGAATCTTTTCACGCGTCTCGGGTTG
GATGAGTCCTGAGATCAGCTTCCAGGCGCTGTAGAAAATGAATGGCGCATTCACAATGTACAGGCAGTGCAGCGTCTCCGGGTAGTACAGCTGGCCCACG
TCGAAGATGGGCTAGAAGACAGACGCCAATGTCAAACCGATGCAAAATAGTCAACCACGACAGCATTGGCAACGTACCTTGAGGTGGCTCAACAccgacg
gcgacagcagcttcatgctAAGACCCTTTAGGTCCACGATACACACGTGTTTGTAGACTCGACGACCAAGTCGCTTGGAGACTGCAGCTTTTTCCCACTG
GATACGCTCCATGTACTGCCACCGGTGCGGGATAATATCGTTGACATTCGCGAACGCCTTGAACAAGCCATCCGGGTTGACGTCGCTGATGCGGTCCACC
GTGACGAGATGCCCCTCCTTATCTTCACCGTAGATGTAGGTCGGCCAGTACTCGTTGTATATCTTGGACATGGGCAAGTCGTGCTTCAAGGCATTGTCGA
CATCGTGAGCAGTACGCGCCTCCAGGATCTTCTTGGTCTCGGCAATCGTGAATTGCTGACGGTTCTTCTTCACACCGCGATACGCGCGAGCTACGCGGAT
CGCCAGGTCGTCCGTGCAGTGGTCACCGAATTCTGCCTTCACGGCATCGTAAAACGGCTGATCCTCGACCGAAAGGGGCTGGGCCTCTTCGTTTTCATGG
AGCGACATGGTGTACGATGCTGCTTGACTCCGCTGCTGACGGTCGCGCCGGGGCTCCAATCTACAAATGCAAGAATGGATAACAGCAGAAACCGCTCGTG
TGATTGTGCCGCAAAGCCTCGATGAAGCCTCAGCGTTCTGAGCGGACCTGAACACGCAGCCAAAGAGTCAGAAAGCGGTTGCACGCCTGCATTTAGGCGA
GGAAAACTGAAATTAGGTGACAACGGTTGCAGTGGTCATCATGCTCCTGTTCCTCTTGTCTATCATTATCTCGGACACCAATCGCCACGGGCGACCACAG
CGCAGCACAACCTTGACCtgcgttgaagctgctgataGCTGTCATGGCTGTGTTTCCGCTTGCAGTCCTGCATCCCCCGTCTCTTCCCACACCTGCGTGG
CTCCCTATGATGGCTTGGACCTGACTGACGCTTACAGACGAGTGACCTCCCAGTCCTCCAccgtgcgctccagcacATCCTCGGGCGTCGTGTCGAAGGG
GCCCGTTTCTGGAAGTAAACAGCAACAAAACACGAAAGCACCAACATGTCAGCTACGAACCGCAGCACCACAGCGTCGGGGCAAAAGCCACCAACGAAAG
GCATTGCGCAACGCACCTGTTCGTCGCGGGTTGTGACGTTCCTTGAGGACCGCAGGCTTAGGGATGATGGTGCccgtcttcttggacacgcgcaccttct
cgccctcgtcCGTGAAGCGGATGGCGACCCGCGTGGGCTTGCCGATGGACGGGTCCACGAGGCTGACGTTGCTGTAGTGGATGGGCGATGGCGACAGGTA
CGagcggccagcggcagcaggcgtGGACTTCACGTAGCGGTGGGACTGAAGGCGATAGTAGCAACAAGGTCAGCCTCTGTAAGCCTCCAGAGGTCTCTAG
AACTCcgcggcagctccgtcagACACGCACCATGTTGGTATTCTCCACGATAACCTTGTTCTGGTCGCGCACGACGCTCACGACCTCGCCCTGCGTTCCC
CGGTGCGGTCCGGCGATGATCTCGACCTGGCAGTGTAGCAATGCAGGGGTAAACAGAGCGCTATCTCGGTCAATACGGCGAGTTTAGAGCCGCAAGAAGC
GCACCTTGTCGCCGCGGAAGATGTGCCAGGTCTTGATCAGGTCGatcgctttcttcttggcgcgcggGCCGCGACGGAAGGCAATCGGGATGCGGGTCGC
CATCTTGACCTGCAGGGGGCTGTTGCTGTCCACAAGTATGCGAATGGGACGAGAGGAAGCAGCTCCTCTCGTCCATTGGCTGAAAAGAGCCTCATCAAGC
TCTTATCACTCACTGGACAAAACGTTCAATTATTGGATTGGCTAAAATCGCGCAGCCACCAGAAAAGTCGAGGTTACAGGAAGAAATCCCGAGCCACCCG
CAACCAGCCAAGCTAGCGGAAGGGGGGGAAGCACTACCAAGCAATATCAACGATGGCTGACGTcgccgagaagcaggagctgccgcccGCGGGCGATGCC
GCCGTGGCCCCGCCCGCCgtgcccgaggacgtggccgccatgttcgacctgaagaagaagaagaagaaatccaagaaggtcaagaaggaggtgcgTCTGT
CACGGGGAGCCCCGTGGCTTGTATTATACGGTATTATATTCTTTTCCTAACGCATCTACGTCATCATTCATGACCCacagaagaaggagaagtcggagga
cgccgaggccgccacggacgccacggccgacgccaactcggtgctggtgcaggacCCCGCCACGTACTCGtacaaggacgagctgctggcgcgcatcatg
gccaagctgcacgagaacAACCCGGAGCTGACGGACCGCAAGCGGCACACCATGAAGCCCCCGCAGCTCATGCGCGTGggcaccaagaagacgctgtgGG
TGAACTTCCAGGAGATCTGCCAGATGATGCACCGCTCGCccgagcacgtgctgcagttcacgctggccgagctgggcACGGAGGGATCCATCGACGGCAA
CCAGCGCCTCGTCATCCGCGGCCGCTACGTGCCCAAGTAcatcgagtcgctgctgcgcaagtaCATCACCGAGTACGTCTCGTGCCAGATGTGCCGCTCG
CCCAACACCACGCTCACGCGTGACTCGGTCAGCCGCCTCTACTTCGTGCACTGCCAGGACTGCGGTTCCTCGCGGTCCGTGGCTGCCATTCGCTCGGGTT
TCCACGCCGCTACGCGTGCCGACAGAAGGGCCGCCCGCAAGTAAGACTGCCGTCTGCCGTCTGCAGTTGCAGGCGCTTAGGACGCTCGACGGACGCCAGC
AGAGACGGTCGGGCTTACGGACGGACAGTTTTCAGGTGGAGGAGGGGAAAGGTTAGAGCAAGAATTGGACACTCCGGAGCTATGGCACTAGAACCCTCTG
TTGCAAGCCTTAGAGCTGCTCTCGCGGGCTGTGAGATACTCTGAATCTTTGGAGGATACGAAGCGCGAGAGATGAacacggagaagaagaggaaaTCTAT
TATAGCTGTTCGGTGTCACTAGGCTAGCTAAGTCTTGTCTTATCTGCATTGCGAGCAGTCCTAACTtagtggtggtggtgcttgcccttcttggaCGTGG
GACCGTGGCCAGCATCCGCAGCAACACGCTTCGCACCATGGCGCGAGATAATGATATGACGCTCGAGCCCGGAGCCGGTGCTCTCGTGCGCAAGGCCAAC
GCGCTCGGCACAGTCGTGTGCCAGCAGTCGCTCGAAGCCGTTCAGGTTCGCGTCCAGGTGCAGCTCGTTACCCTCACCCGACTCGTTGAAAgcctcgatc
ttcttcaccaaAGTGTGCGAGCTGCCCTCCGAAATACCCCCAGACTTGTGGTTGCGTGCCGGAGCCGGTGCCGGAGCCGGTGCCGGAGCCGGAGCACGAC
GCGGAGCAGGAGTAGACTTGGCAGCAGGCTTAGCCGGAGGAGCTTCATCCTCGGAAGAGTCTGAAGAGtccgagctcgacgagtccgacgacgaagccac
TTTCTTCTTTTTGGGGGCAGGCGTCTGCTTGGTCTTCGCCGCAGGTTTGGGTggagcttcgtcttcagaTTCATCAGAAGACGACCCGGAAGACGGCTTT
GCAGGAGCAGCCTTCGGTGCTGGCTTCTTTGTCTGCTTCATGACCGGCTTGGATGGAGCTTCACCGTCGGAGTCACTTTCAGATTCAGACGATAGTTCCG
CCAGAGTCGGCTTGCgagctggcgtcggcgtgggCTTCGAAGGAACCTCACCCTCGGAGTCACTTCCAGACTCGGAAGACGCATCTGCCTtggaagctga
agcaggtgCCGGGGTCGGCTCTGGGGCTTCATCATCGGAGCTGTCGGAATCGGAGGACAGCTCCATATTCGGGACAGATGCAGGTACCGGCTTTGGCTCA
GACTCGGACTCCGATGCCTCAGAAGCCTGCGCTTGCTTCTTCGCGAGGCCCGCTGGGGCCGAAGAGTGCGGCTTGACATCGTCAAAGTCCTCCTCGGACT
CTGTTTCTGACGCATCAGCCATCGGctcatcgtcgccatccgCCAATGACGCAGTGACCAGCGCTGGGCGCGGCTGAACAGGTGAGGCTTCGGCcatctc
ttcgtcctctgaCTCGGACGATTCTGGATCACTAGAAAACTCAAGCTGTGGGACGCTCTCGACGTAAGACACGGGGGTTGCAACCTTGGCTTGTGGTGCA
GGATCCGCTTGAGCTTGCTTTTTCTTCCCTTCCTTCTTCTTAGCAACCTTGGGCTCCTCCTtggtcttcggcttcgccttctcaGTCTTGCCAGATAGTT
TTACGCGGGTGTGTTTCCGCAAGCTCTTAAACTTGTGCACACTCGCATCGCAGGAAGGACAGAACGGGACCTCGCACTGTTCGCAACGCACGCTAGCAGT
CTTAGATTCGCACTCGCCACAGCGCGGCAGCGTGGGAACTGGCGGCGGAAGCTTCGCTCGCTTGTGTTTGGCCATCACGCGAGCACGATGCACGGCCGAG
TTGCAGCCATCGCAGTAGAGCGAGTTGTCGCACTTCGCGCATTTCCACACGGCGACACCCGGCTTCTCGCACTCAACGCATGCACGAGTCTCCTCGTTCT
GTTCCGTTTCAGCCTCGCTCTCACTCTCCTCTTCACTTTGGGCAGAAGACTTGTTCGCAGACGTAGCAGCCTTGGCTGGAGACGCCTTCTCTGGCGCGGC
GACTGCTTTAGGCTGGTGAATAAATCTGCAAGCGTCGCCACGAGTGCACACTCCGCTGAGGTGGAACTGGCACAGCTGCGCAACCTTGCCCGTAGGTGCA
GGCACGGCGTCCTTCGACACCCCCAGCACATGTGCAAACCTGCATTCCGAACCTTGCGCACAGAAGCCACGAGTGAAATGACGGCAGAGCTGCGTGGGTG
GGATCCCTTGAACGTCGGACGGAACAACGGTCGGGGCAGCaggcttcggcttcggcgtcttcttcttgagctcgcgcggAGCCTTGGCAACGGCAGgagg
cgccgacgacgcgaaAGCTGCGGTATCTGTCACGTGGTAGTACTTGCACAGGTCGCCCTTGCGGCAGATTCCGGCAGCGAAGCCGCGGCACGgctccacc
gtcttcttgaacttgcgctgcagcgacaccttgagcgtcttgccATACACTACCGCGCCGTTGGTcgcctccacggccttgagcgcgtgtTGCTTCTGCC
CGAAGATCACCTGGCTGCATCAAACACGACAACTGAGCACAAAAAATGCAGTGACAAGCACGACGGAGCGTGGACGTACGCCGAGTTGGTTCCGTTGTGG
CGCACGCGCACGATGGGGCCGTAGGTGCGGTACATGTTCATGAGCATGCCATCGGACAGCTCCGTGCCGATGCCCGACAGCACGATGGTCGCTTCCTCGC
CGACGTGCGCCATGGTGAAGCGGTTGGCAACTTGCACAATTGACTTTTGGCTGGtcacggacgccgagctcCATATGTCACTATAACGAGGGTATTATTC
GGGGTAGTTACTGACACTTGGACATTATTGGGCAGACCATGAAGGACGAcgatcgtgcagctgctACGATGACGGGGAAGCGACGGAGGTCGGTGGAGAA
TGGagcagaggaggaagagacgGAGGCAAACAATGTGCAGGCTGAAGAGCAGacgagcgagcagcaggtggacggCAATGGACatgcggacgagctggag
gacaaagctccagctccgactgcAGCAGTAGACGACGGTGATGCAGAAGCGagtgaagaggaggaggagatgctggtggtgctggagctgtgcgACTTCA
AGAACCACCCGCTGTTCGACGACTACAGCGCTGCGACGCTGGAGGTGCGTGGGCTGTTGGACGGCAGGCTGTCGAAGCATTGAGGCTGacgttggagctg
ctgggttgGATTAACGACATAGGGCATCGACACGGCGACTCCGATGCTGAAAATCGGAGAGTATGAGCTGCACGGACAGTTCGAGGAGACCGTGGGCACG
AGCTACTTCTACGACACGGACACGACCAGAGTGCCGGACAAGACGTACCAGTTCGCAGGCCAgaccatcaagaagatcaagtTCACCATCGCACCGCCGG
AAGACGTGTAGTGCGACGGCGCCGTAACCTCAATGCATTCT