Description :
From Genome Similarity Track
Location :
Scaffold_575:2345- 3620
Transcript NameFunction/comments
Pytul_var.sporangiiferummaker-pug3_contig_575-snap-gene-0.7HECT ubiquitin ligase

Sequence
1275 bases(100 bases per row)
TTAGTCTGTCGTGAACCCATAGAGCTCCATGTCCAGCGTCGCATAGAGCACAGTTTCGAGTTTGTCTCGCGAATCATACAACGGGAGCCCAATACGATTG
AAGCACGTGTGGCTCCAAATGTGATCTTTCTTTGGATCCGTCTCAGCGTGCAGAGTGAAAGGACTCAATTGGCCGTCGTTGCTCAGAAGCGCACTGAACC
CAGCGATCGGTACTCGGGACGACCCGGTGGCGAAGTGCAATAGNNNNNNNNNNTTCCCAGAACCAGCGCAGCACGCTCGAGCCGTTCAGATTCACCGAGT
TGACCGTGTTCGCCTGCCAATCGGCGACGTCGATCTCCTGCGTGCCGCAGAGCAGGTANNNNNNNNNNGGCGATACTCGTTTGGCATCTCGTGTACGAGC
TCCCAGAACCACTTCATCGCGGGATGACGGTGCAAGATCGGACTGCATTGGCTGCTGCGCTTCCAGTCAGCGACATTGATTTCGTCCGAGCCACATAGCA
TGTAATCCAACTCTTCGGGGTCAAACACCGCGAGCAGCTCCATCGGGATCACTTCGTAGATGCCTTTGAGAAACGCATAAAGCTGAGCCGACACGCTCTC
AAACAGCAAATACTCGAACTTGCGTTGCAGATATAACTGTTTGTTGGCATCTGTGACCGTAGTGTTGCGGCCATCTGGGATCAGGTCCACCACAACGAGT
TCTCCAGCCCGTGTATCCATGACACTGAAATCCAGACCAAGCGCGACTGCGCCGTCGTTTTGTTTCACCCACAGCATGCTCTTGTACGCCTCGGGGTCAA
AGTACTCCAAGTCGCTGAAGCTCACTGGGATGCCCAGGATGATCTTGAGCAAGGGTTGCGCCAAGTGGAAACCCATCACTTGACCTTCCAGCAAGGCGCG
ACCGACCAATCGTCCTGCTCCGAGGTAATACATAAGATGCGCCTCGCCGATATCATGGGCAGAAGATGGATTTAAATAGTACGTTTGCTCGGGTTTGTTG
ACGCATCGAAATACGCCGCGCGCCGGATCAGCGAGCTCCTGGTTCAGCTGCATGAACCATTCGCGCTGTAAGCCCCCGGCATCGACACCACGGTCGTCAG
GAAACTCGATTCGCATCGCTGACCGAATGTATGCAGGTGGAATGACGCTGAGCGATTCCATCGAGTCATCGAGCAAAGCATTCCTATGGACGCTGAGGGT
GACGTATTGCTGATCCGCTTGTACAAGTAGCGCCGCCGTTAACGTCACGAAGCGTGCATACTTTGTTGGGAAATC