Description :
From Genome Similarity Track
Location :
Scaffold_134:23442- 27568
Transcript NameFunction/comments
Physo_143279cutinase
Physo_143280cutinase

Sequence
4126 bases(100 bases per row)
TCCGACACGAGCCGAGCGCCGTCACTTCCACTTTTGCTCAAGTTCCGCACACATGATTCTTCCAGGTTTTCCACGCGCATTATACCTGGTCAGGTAATTT
ACATAGATTACTTTCATCGGATTCGGCAGGGTTTCGAAAAACCTGTAGATAACCTGGAATAAAACTTGGGCAATACCTGTGGAATCAGTTTTCTGAGAAA
AATCTGAATCTGGGAAACCTGGGCGCTAAGGCTGTCCATAACGAAAAGGCGAAATCAGCATAGAGCCGACTCTAACTACACTCATAATCATACTTTCATC
ACTACTTTAATTCTTCGCTGACAACGTGGTATTTCAGAGCCCGTCGACATAACTATTATGTATTCGGCCTCTTAATATCCTTCTCACTCCGTGCATCAAG
CTCGGCATGCGCTTTGCATAGGCAACTACATTAACAAGAACCCAAACAGGAAGACGAATGCAGTAGCAAAGCTTAGTCAAGAAATAAAAACTAGGTTATA
TTGGTTTAAACCAAGGTAAACCAAAAACCTATTTCGTTTTAAAAAAATCGGCAGGTTTTACCAGCCCTGAATCAAGCCTATCTTTTAAGATAACTGTACC
GTTTATGGATACGAATAGTCAAGGTTGGTTGTCTTAACGAAATCATTCAGCTTTAATCTCAGCATCCAAGCACCGGCGACGATCGGTGCACTGCGGCAAG
ATTGCAAATTTAACTGCAAGACACTGTGCAGTACGCTCAATCGTTTGCGGTTGATCTGCGTGCCAGCTACGTAGCCCACATGTACTTCCAAGTAATCTGC
TTGAGCTGCATCGCCTTACACGCTGCGCTTAAAAAAACTCAGAACTTCTGGTGAGGTTTGTGCAGGGCTTGATACTGACCACATGCTATTAACAACCCAA
AGGTGGGCAACCCATTGCTCTTCTTTCGTTTTTGTTTACCCGACCAAATTGCTGAGCAGTAACGGAGTAATTCACCAGGTTGCTACAAGTAGAACCACCT
TTGGTTTGCAATTCGTGAGGAGATGCTGTATTTTGCGTTCAATAAATGTTGTTGGGGTGAGTTATTCCAAGGTAAAATGGTCGCTGGTCGCATTCGCGCG
TTATAGAATGTTCGCACGGAATCCCCACTCGCAACAAATGCTACTCTGTGCTTTTCATTCAAATAAACGCGATAAGTTTTTTTGTGGCGTCTTTTTGGGC
TCGATCCTGCATTGTAGACGTGCAATATATGCGGAAACGGCAACTGCGTCAACAGCCCAACTAAATCTAACCGGTAATGCAATCATGTTGTAACACTATC
ATTGGCATCACACTGGTAAGCTTTGAGAGTCACATCTGCGACCCAGTGATTGCGGGCTAGATTTGTGGAGGATAGTGTTTGTTTATGGGAAAGCTATGAT
TTACGACTGTGTAACCAGAGAGTGCATTCAACTCCTGTTGAGACCACCGCACCTCCTCGCGTTTAGCCGGCACTCGCAAAGATATTAGCTTTGAATCGAG
CTGTGATTGTTTCCCGCAGCGCGCGCAGTTTATTGAGATACCGTTGCGAACAAAGGTTATTGCCCCTTGCAAACTACATGTAGTTAGACGGCCACCGAGT
TGGTGCCGTCTACCGGCTGAAGGAAGGATCTATAGCGGACATTCTGCCACCGCTTTATGCGTTCGTTAACCTGCTGTCGAGTTGTCGGGCAACAGCTTGC
TCAGCGCTGGCCATCTTGGTGCGCTTCAACCATACCATGAAACAAGCAAATATCCGCTGGATAAGATGTGGGTGTCCTATTCTTTTGTACGTATGTTGGC
CGCAAGTTTTCATCAACTCACCAAACTGTGTTGATTTTAAAGCTCGAGTAGCCACTGCACGTCATTACACATGCCGATAAGATCTCTTAAGTTTGGAGAT
TGCGATCAACACCTCAGCGAATATGACATGACGGCACCAGCAGGAGGCATGACTCTGGCGCCGGCATCTGGTGAGACCGTCGTTTGTATTCAAGGGGTGG
AAATCCGACTTCCTATTCGAAGTTTGCTGTGGGTTGCGAGGGGCTCCGTTCTCCGATCATTTGACAACTTCTCTTGTCTCGAGCAAGTACCAGCCAACTA
ACTACCCCTCATCGACCGCCACGATGAAGTTCCCCGTATCCTGCTCGACAATCCTGAGTGTGCTTGTGCTGCTCTTCAGCAGTACTGCCAGCGTCAACGC
CGAGTGCTCCGCCGTCCACATCGTCTTCGCTCGTGGCAGCGGAGAAATGCCAGGTCTGGGGATTTGTGGTGGGCCCCTCGTGAGCGCGATCACCTCGAAC
CTCGGCGGCATGAGCGTGTCATCGTATGCTGTCAACTACCTCGCCTCCGTGACGCAGACGAGTGCCGGCCCTGGTGCGACCGACATGACCAACCACGTCG
TGGCAGTCGCACGGCAGTGCCCCAACACCGTCTTCGTCCTGGGTGGATACTCCCAGGGCGCCAGCGTCACCGACATCTCGATCGGCATCAAGACGATGCT
CGGTGTCGGCAAGAGCATCCCGGAGAATCTGGCCCCGCGTATCAAGGCCATCGTGACGTTCGGCAACCCTCTGAAACTCATGGGGCAGACCATTGCGCGC
TCGAGCCAGCTGTATGGGTCCAAGGCGATCGAGTTCTGCAACTTTGGCGACCCGGTGTGCGCGAACGGGTTTAACACTATGGCGCACATGATGTACCCGA
TGGACGGCAGCGTGACCAAGGCGGCCCAACGAGCGGCCGCACTGGTGAAGGGTGGTGCGAAAGCGCTGCGTGGATAGAGAAGTCTGTTGAAGTGCTGAGG
CAGGAACTTGCCGTTGCTTCTGCTCCGCACCAACGTACAAGTTGTCGTGTGTACGTCGAATGTCATGTGGACCCCAAGGGTTATAGATGTCAATAAATAA
GTTGGTTTTTTGTATGAGCTTACAAGAGCTACGATAGAAGATCAATATATTTTCCATATAAGTAAAACAGCTTGTTCATTGAGATCGATGACCTTTGGGA
CCCACATGAAATTCGACGCATACACAAGTAAAATGGTCATCTTATGCCTGTGCGGCTCTGACAGACCTTAATGCACGATACGCCCCCGCACCACCCTTCA
CCAGTGCGGCCGCTCGTTGGGCCGCCTTGGTCACGCTGCCGTCCATCGGGTACATCATGTGCGCCATAGTGTTAAACCCGTTCGCGCACACCGGGTCGCC
AAAGTTGCAGAACTCGATCGCCTTGGACCCATACAGCTGGCTCGAGCGCGCAATGGTCTGCCCCATGAGTTTCAGAGGGTTGCCGAACGTCACGATGGCC
TTGATACGCGGGGCCAGATTCTCCGGGATGCTCTTGCCGACACCGAGCATCGTCTTGATGCCGATCGAGATGTCGGTGACGCTGGCGCCCTGGGAGTATC
CACCCAGGACGAAGACGGTGTTGGGGCACTGCCGTGCGACTGCCACGACGTGGTTGGTCATGTCGGTCGCACCAGGGCCGGCACTCGTCTGCGTCACGGA
GGCGAGGTAGTTGACAGCATACGATGACACGCTCATGCCGCCGAGGTTCGAGGTGATCGCGCTCACGAGGGGCCCACCACAAATCCCCAGACCTGGCATT
TCTCCGCTGCCACGAGCGAAGACGATGTGGACGGCGGAGCACTCGGCGTTGACGCTGGCAGTACTGCTGAAGAGCAGCACAAGCACACTCAGGATTGTCG
AGCAGGATACGGGGAACTTCATCGGTGGCGATGCTGTGTGTTGTTACTGGGACTACTGTAAGACAAAGCAAATGTCGAATGACATACGACGTAGAGCCCT
TGACGCGGGCGGAACGGCAGACGCTGTCGAGGATGGTGGATTCCGCCCCTTTGAAGATTAACAACGTGGCTTAGTCACGTGGCGTAAAAGTCCAATCGAT
CTCACCAGATGTCGGTACACAAATGATAGTTTTGCTGTGTGCTGTCATGTACGCCAGGATGTTTGGCCGCAATCCTAGATTAAATACATCTTATCAGGAT
AGGATCTGTGACGATGCAACTTAACTCAAATACAGACGGTGATTGATATACTTTAGTACAATAATAGATATGGTCCTGCTTGTTCAAAGATTCTGGACAA
TTGTATCCGATAGCATGGTTGCAGCG