Description :
From Genome Similarity Track
Location :
Scaffold_274:23438- 44104
Transcript NameFunction/comments
g11110.t1hypothetical protein
g11111.t1hypothetical protein
g11112.t1hypothetical protein

Sequence
20666 bases(100 bases per row)
GATTTTGGTCATGAGACCTTGATCACATTAGATGTCTGAACGCAGATGTCTGAACGCAGATGTCTGAACGCAGATGTCTGAACGCGGATGTCTGAACGCA
TGTATTATACGTGCTCAAGACTATCCTGTACTGTGAGGTCGTACACACTGGTTTCAGCTAAATGTCCAAGTTGAAGAACCCTGAGCGTGAGTTCGAAGTA
TCTACGTTCAAGGAGATTGGAACCTGAAAATGATGTTCAAGGTCAAGTACTTGAAAGTAGGTTTAAAGAACCCACGTTCAGACAACCCAGAACCCAATGC
GAGGATTTGACTCCTTGAAGATGGAAAGTGAACCCACGAAGTGACAGCCAGTATACTCAAACTAAGTCAAAGTCAGAAGGTCGCTATGAACGCTATGAAG
AACACAGAAGAACACAGAAGAACACAGAAGAACGAAGACAGACAGATACCCTTTACGAAGAAGCTAGCGATCGGCTAGCAAAGATAACAATCAGAGTTCG
TTTAACCCCCTACTACGCAAGTCGCTCAAAGTAAGTGAGCTTCCGACAAGCAGGACACGGGTCCGCCGTTCAGTTAAGGGCAGTTCGGTGCGGGGCTCTC
TACAAAATTCAAGCCCAGTTGCGAGGGGATCATTCACGTAAGTATTTGACGTGATCCTTGCATTCCCTTTATTAGTTGGACCCGCTGCGCGTACGGTAAG
GGCGGGGTTTTCATTTCATATTAACAAGGCCTTCTTGGGTGATAGTAGCAGTCATCCCCAGGAATATTTGATAGACTGCGTTTGAGATAGGATTGTATTG
GTGTGTATTATTTCCCTCATCTGAGGGTGGTGCGCGTGTGAAGAAAAGGCTTCAGGATTGACCAGTATCCTGGGTTCAGCCTTAGTTGACTGGTGTTCAG
ACCCACCGTTCAAGGGTCTATAAGAATAAGTAACGGCTGTGTGTTGTATATAACTCTGTATTTGTATTGGGTATCTGAAAGTGGTGTTGTTCCGAGTTCT
CAATACCGGTTCCAGACATTGGAGAAGTACATTCAGGAAGTGGACGTTACGCTCAGCATCTTCAAGGCCTATTTGTATTTGACAACTCATTGTGGTGATA
TATCCGAGCTTCCCCCGAAGCAATCGACGCCGATAGGGATTACACAAGGTGCCACGCCACTCTGAATCACGGTTTCAAGGAACCGCGTTCAGGGTTTACA
CCCCCCAGGCTTAAGTTTCAGGACTAAGTCTAGGCTACCGCTATACACTTGGGCGAGAAAGTTTCATCGACTTCGTCACAACTGGTGCGCGATCCCGGAT
TTGGGGTCTTAGGATTTCACCGGAGTTGTTTATATTAGTAGGAATTGATTAGTTGGGTCTCGTTAACTTCTAACTACTCTCTAATGGCGGGAGGACGAGG
CAAACTGAAAGGAGGACGTGGAGACGGCGGACAAGCAACACGTGTGTCGCGCCGAGCGCAAGGACTGCCTGCAGAAGAGCATAAGGACTTGGACACAATC
GCCCGAGAACGACGTGCACGATTGAAGGCAGAACGAGAGGCGAAGAAGGCTGAAACTGAAGACCAAGCAGTCATCGAACTGGAAGCTGCGGGAGACGTAA
TGTCGACTGCGGAAGCTGGTACTGGTAACCAGCGGTCAGAGGTGAAGCCTCAACACATCTCGGAGGAGCAGTCTCAGTCAATGGAGACTGCGCAGGCGTC
TGTGGGATGCGCCAACGAGGTTGAGACCCCAGCAGTGGATTGAGTTTCGGACACTCTGCTGCCGGTTGAAGAAGAAGAAGAGCTTGCTGAGGAAATTTAT
GTCATCCCTGTGGAGAGATTGATAGCTGAAGATGTCAGGGACGCATTGCATCCAGTACCAGCGTGTCAAGATCCCTCGTCGCACGACTTAGCACCCATGC
CTGAAACGGCACCGACACGCACACTGAGTGAAGAATCTGCGCTCCAGAACCTGAACGCGGATCCGCGTTCAAGCTTGACTGTGGAAAGTAACTCAGAGTT
AGTGACCAGAGAACCTGATTCAGCACGGGGCGAGGACACGTCGAAGGAGTTCATCGCGCGACAAGTACATCGCTGGGAACAAGTGCGCTCAGGGTTGGTC
ACTCCTCCGAATGTGGTGTACGAGTGGCCAACACCTGCACTGGACTTCTCGGTATGGTTGGAAACAGCGATGAGGACGTCTGACTATCTGCGGCACCGTA
TGGCTCTGCCAAACCTGGATGCTGCCTGGATCGTCGAGCCGAACCCTGAGCGGAGGACGTTTGGAATTGCTGAAGACCTGACTGCGGTCACGGTTTCTCC
AACTAGGATGACTCCACGTGAATGTGCTGCTTTCGTGCAAACTCTCTTCTTCGAAGCTGGATTTGAGTTCATCAACGTGGTCCCAGATTGGTATCGCACT
AGAGCCTCTCAGATTGTGGTTGGATATGTTCGCTCAGTGGTTGAGGGAGTTCAGCAGCTGATCGCGATCGAGCTCTTGGAGTGGAAACAACTCACTGTTG
ACTTGCCGTTCAAGATTGTCCCAAACGCGGATGTTCTCAACCCGTCTGAAGTTTTGAATGCGATCAAGTATGAACCCATTATGAAGCTGAACGCGGAAGG
TGAAAGCGAAGATCGATTGATGTCGGATTACGAAGTAGAACTGCTGGGGAATTCGTTTGCTTCACTATGTCGACTCGTGAGCATCACAGTGCTCAGAAGT
CCTCGGGGTCCCCCTGAAAGTGAACCTGAAGCGAAGCGCCCTCAGCGTAGACCTCCTCGCCCGCTCAGCATCTCGACACCTTCGGATCATTCGTTGCGTC
CAGCCGGAGATGTAGGATATGACACTGAGGATCAAGTGATGACCAGCCACAGTTCAGGAACTCTGAACGCGTCGAGCAGGATTTCCGATTCTGTCCCAAG
TGTGATTGGTCCTTCAGGCACCTCAAGTGGAACCGCATACGACACGTCACCAGGAACGCAGACATCCAGAGACAGCTCGTCCAGTTCATCCATGTTGTCG
TTGGGGCGCCCAGCCTCAGCGCATATGTCTCACTCAGGATCAGTCCCAGTGATGATGGCAATCCAGTCTCAGGGGTACCCGGGTGCAGGATATGATGGTG
GAGCGTTGGTGACGCGTACGCTGATCCCAGCTCGACCTGCCTCGGTGGATCAAGATGATGTCGACATGGCTGATTCAGAGAGTGCTGGCGCTCAGGATGC
TGAAACCGCTTCTCAACCGAGACACTCTCAAGCGCGATCGACGGTCAAGTACGGAGGCTCGGGTTTGGCACCAAGCGAATCAAGTTTGAGTGCTAGGACA
CCTGCACATTCGACGCGGACGAAGTCCAGTTGCACAAGCAGATCACGTCGGTACGTTCGCACTCTTCAGCATCATCCGGAGCAGCACCAGTCGCCCTGAA
CGTCATGCGTCAACACCAGGAAGCAGTTGCCCAACTCAAGGAGCAGCAAGAAGCGTTTCACGATCGGCAGTATAAAGCCCAGCTGGAAATGCAGCGCAAC
ATGGATCGACAGCTTCAGGGTGCTGCGTTTGAGATTCGTTCGCTGAATGAACGCACAACTCGCGCCGAGGAAGCAAGACATGCCGCTGAACAAGCTTTGC
TGAATATCGAAGAAGCTCGGGTGGAGGCTGAACGTCGCGCTCAAGCAGCTGAAGAATCGTTAGCACGACCTACTCCCAAGACGGAAGAAGCTGCACCTGA
ATCTCATGAAGAAGGGGCTGCCCGGCTGGAGGAAACCATTCGTCTTGAGCGCCAACGTTTGCAGGCTGAAAATACTGAACAACTGAGGCGTGAACGGGAG
CTGGGTCAACACAACTTGGAGCAGGCTTGGCAACAACGTCTTACCGAAGTGAATGCTGAACGTGGTCACATGGAGAATGAGCGAGCTGAGCGTGACAAGG
AACTGAATGAAAGCCTGAATGCGCGCTTGGAACGCGTACAGCAAGCCATGGAGCATTTGAACCTGGAGCGGGAGCAAGAACGTGAGTCCACACTGAATCG
CCAGAAATTTTTGGCCGACCAGAATCGCGATCTCCGAACTGTCGTCTCCCAGATTCAAGCTGGTAAGCTGACCACATCCCCTGAAGTGACAACCCCGATA
ATTGAGAAACCCTCAGCTGAACCCCATTCGGCAACCAAGAGTTCGGTGGTCAGTGGCGTAATCAAGGATGGCGTGCGTCCTGATACAGAGTCGGTACCGT
CGAAGAACAAAGGGACGAAGGCTCAACCAACCACAACCACTTCAATCGTCAAAGCGGAAGGTTCCAGCAAGGAATCCAAGTCATCTGTGCCTAAGAAGAC
TTCATCCAAGAAATCAGCGGTCAAGAAAAGTGCAATCAAGAAAACGAGTTTCAAGAAATCTCCGCTGAAGGAAAAGAAAGGTGCAGATCCTCCATCTTCA
GATCCAGATGAATCTGATTCAGACTTGTCGAGCTCAGATGATGATGATTCAAGCTCAAGTGATTCAGACAGTAGCTCCAGTGATGAGGCGGATCCAAACC
TAACCACTATGTCCACGACGGGTAAAGACGGTCAAACGATTTGGACCTATCGACCGTATATTAACTACAATGCGGTTGAGAAGTTTGATGAAGATGCATC
TCTCGAAGACCGAGTTGGATGGTGGGAGCGTTTCACTGATATGGCGGATCAAGGTTTGTGGCCAGACAAGATGAAGATCAGACAGCTGAGAGGGAGAGTG
TCATCGGCTCTCAGAGATTGGTATGTCCAGCTGCCTAAACATGTTCGTCATGACTGGAAGAAGTTGACACACCGTTTCAAGACCTTGTATTGCCGCACAA
CTGGTTCTTACTCGGAGCGCTACTACACTATGAAGATGCGTTCAGGAGAATCCGCGCTCAAGTTTTTCTATCGGCTCAACGCTGCTGCGGTCAAGGCTGA
GGTGGAGTTTCAGAAGACCACCAAGTCTCGCGAGAGGCACATTCGTCGCTTCATTAAGAAGCTGAAGGACACTCAGCTGAAGACCGCATTTCAAGGTCAG
ACATTCAAGAGCATGAGTGAGATGGAATATGCGTTGAGACGTAGCGAGGACATTTGGCGAGAAGAAGGATATGACACGCCACCGGCCAAGCAGCTGTATC
AAAACAATGCTCAATCACCGCGATACAAGTCTCGGAAGATGGGCAGAACGTACGTTGCCAAGATTGAGCCTGAATCAGATTCTGAGGTATCTCAACGTGT
CCAGTTTGAAGAATCTGAAACGGAGGAGAAAATGTCTGTTCCTGCTACACAGGTAGTGCACGCCAAGGGACGTGGTGTTCGGCAAAATGAACCTGCCAAT
TCTGAAACACAACCCATGCTTAGCCTGGAAGATGTCTCAAACGTCGTTTATCGAGCTATGGAGAATGGTGGATGGAAACCTGGGTACAATCAGCAAAATG
TGCGTTCAGACAATGCACGCTCAGGATATTCGCCACATTTTCCACCCTGTGAGAGTTGCGGTCGCCATGGACATTCGAAGGAGTACTGCTGGTCAGAAGT
CATTTGTGATAAGTGCGATGAAGTTGGTCATCCTGCGATGAACTGCCGAGTAACGCCGTGTCCTGACTGTAGCCAGTTTCATCGTGGATTCCTGTGTGAA
GAATGGAAGGCGTTTCAAGCTGGGAAAGCACATGCTCGTCAAGGCACGCTCAAGGAGTAGCCAGACCAAGTTCAAGACCAGCTACGCGAGGACACATATA
CGTCTGGGAAGAAGCCGTTAAACCTGTAAGCCCGCTGGATGGGGATCCAGCACGCGTCGGGCTCAAGAAAACCCCAGATGTGTGTGTATTAGCGTATGTT
GGCCCAAGATCGAAAAAGAATCAAGATAACCAACACTGTATGACTGCAGTTCAAGATTCAACCTTCAACCCTGTGCGTTCAGACCTAGCTGATGTCGAAG
TTCCTGTGGAATATCAGCTGAAGCCTGGAGAACGCTATGGTTTGTGGGAGGATCATGAACCTGAAGACACGCATGAGATTGCAACGGTTCATGGAGCCGT
GAATGACTGTCGGACTAGTATCCTCCTGGATACCGGTGCATCTGTGAGCATGCTGAGTTTTAACTTTGCACGTAAGCTCAAGCTCAAGCTCTGGACGCAC
AAACGGATGAAGGTCTTAGGCCTGGGAGGTGTTCCGACGTATATTTCAGCTCATGCTGAGATCAAGATTACTCTTGGCCCCAGGTTGGTTTATGTTTTTC
GAATTTGGGTGGCGAATATTGGTGAAGGAGTGGATGTGTTGCTGGGCATGAATTTCATGTTCAGCGCTGGTGTGAGGCTATCGATTCGAGAAGGACTCTT
GCAACTTCCAGATGAAGAGACGGTGCTGATGTATGGTAATTCTCCCAAGGATTATATAGGCGCGGATTTGCCGGTGTGTCCAAAGCAGAATCTGTATCTA
CGCCCAGGTGAAAGTGCAGTGGTTCGTGTTGACTATGGTCGATTGAACCCTCAGCGCGGACTTGTGTGGGCTGGGCGTGGTGATCGGTGGGTGACTCAGG
TCATTTTCGCGGCTAGGTCTTGGGTCACTGCGGTTAAGGTGGTGAATATCTCGGACAAGATGCTCTGGGTCGATAATTGTACACAGATTGCAAGAGTGGT
TGAACATGTTTTTTTTCCCACGCTCAGGAAGGTTTGTGCGGCCTGGAAAGAGGCAGTATCAGGAGTGGCAACAATTGATTTATGAAGCCACTTTATCTGC
CCAAGCTCAGATGCGTGCTCGACGTCTTGAGCAGTTGGTGACTGGAAAGCAGAACCCCAGCACTCAGGTCCCTGAGTATCCGTGGCCATCCAAGATCATG
ATGAGGTCGACCCCTGAGACTGCTGTGGTGAACATGGTTCGCACGAATCCCAGGCCGAAAATCTTCGAGTGACGTTTGCTGAAGAAAATTCACGAACACA
TTGTCCAGCCAAGCGTGAATCCAGGACCAGGGACGCTGAAACGCAGACTGAATCAGCGGTGAAAGAAGTTGACGTCCAAGGCCCTGAACCAGACGTTCAA
GAGTGTGATGATTCCGAACGAGTGTTGGTAATGGAGGAAGACACTGGACAAGCTTCACTTTTTGAAAATACACTCTCTGAAGGTGTCACTCAAAATGAGA
GCCTGAGAGAGGACCAGTCTGAAAATGAGTTTCAAGGTTTCTCAGCTCAAGGATTTGCGAGTATGCCTGTGCAGAAACTAGAAGAGGAGTATGCGAGGTG
TATGCGTGTGTCAGCTGAAGAATTGGATCTGGAACCACCTGTCTATATCAGGGAAGGTAGTGAGGCTATGGCTCAGCTACGTGAACACTTGATTATGTTA
CCTGAGGTCCAAGATTTGAGTCCTGAGTGCAAGATCGAAGATGCGGATGTTGGCGTCTCAGGAGTCACGACGCCAGAGATGGAAATGAAGATGACGGAAA
TCCTGAAACGACATCGGAAGATCTGTCTGGGAGACGGAAATGCAGCTCCAGCTCCAGCGCGAGGTATTGTGTGTGATCTGGATGTAGGGGATGCACGTCC
AGTGTATGTCAAGTTGCGCCACATCTATCGATCAAGGTGTACGAGTTGCTCAAGAAATTCGTTGAAACGGGTCTGATTGAGCATTCCAAATCAGAGTGGG
CTTCGCCAATCGTGATTGTTCTCAAAAAAAATGGAGAGGACATCAGGATGTGTATTGATTATCGCCTGTTGAACGACTTCATCAAGCTGTCACGACACCC
TCTGCCACTGATCGATGATTTGTTGATTGGTTTTGAATCTGCGATGTGGTTTATGAGTCTCGACATGGCTAGTGGCTTCTGGGCTGTACTCATGACTGAG
CGCGCGAAATTGATTTCAGCGTTCATTTGCCCTTTTGGACACTTTCAATGGATACGAATGCCCTTCGGACTCAAGAATGCACCTCTAGTGTACCAAGCTG
TGATTAACAATTGCTTGTGGGGTTTTGTGCGCCTGCCTCCAGAAGGGGAAGCTTTGGTTGACCAAGAAGTGTTGCAGTTTTTGAACCTGAATGTTCCAAG
TGCTGAACGGGACAAGACTCAGGATTCTGAACGCACATGTGCTGAAGGTCCTGAACTTGACAAGGTTGAACTACCAATTCTTACGGAGCAGATGACTGTA
TTCAAACGTAACATACCGATGCGTTTTGTGGCAGCTGCCCGACTGGGAAGTAGTGGATGCGCAAGGATTTATCTTGGAGGATGTCACTGTGAATGATGCT
GAGTATCATGGGATAATAAATGGCCTGAAACTGGCATTATCTCGCAACGTTCAGAACCTGGTTGCAGTTGGTGATTCAAGAATTGTGATTCAGCAAGCTC
AGGGCTTGATAAACTGTAATACTCCGAACCTTCAGCGCCGACTTGCCGAGTACGAAGCTCTCAAAGCCAAATTCAAGTCAGTTCAACTGGTACACTTCAA
ACGCTTCTACAATCAAGCAGCAGATTATCTGACGTCCAAAACATTGATTTTAGGTGAGTCTTGGCGAGTTGAGGACGAAGATGAACGACTTCATCTGCAA
TTGGTGTCAAAAATCCCTGAGCAAGTCATGAAACCGACTGAGACTCTGACTGGAGATAAAGATTTGAAGTTCGAAGCTGAATCGAGTCCTCTTCCTCCTG
CGGCCAAGGTTCTAGCAGCGTTTACGCGATCTCAGGTCGAGCGATCCGGATCAACTGAACCTTTGGAACCAGGCAGAACGTTGGCGCCGAATCAAGGCTC
ATCAAGATGGTGACGCTTTCTTCAAGCGGATACAAAGCTATCTGAAAGGCAAGTTGGATGAAGTTTCCCGATCTGAGGTCAAGCAACTTGCCAAGTATGC
GGATTGCTATATTCTGGACTCACGAGAAGTGCTGTACCGCTTGGCTGCAGAAACTAAGGGACGCCCTCGTAACAGAGAGTCTGAGCTGAGACTAGTTGTT
CCTGAAAACTTGCGTCCAGACATGTTGCACTATGTGCATGAGGATTTTCAAGGTGGGCATCAAGGCATAACTCGCACATATCAACGATTGTGTGCAGAGT
GTTATTGGCCAGGTATGTTCGCTGATGTGGAGATTTTTGTCAAAGAGTGCACTGATTGTGCGTCGGCCAAGGGACGACCTCCTAATTCTGGACCTTCACC
TGGAAATATCGAACCTCAGCGCCCGTTTGAACTAGTGTCAAAGGACTTTGTCACCCATATGCCCAAATCTGAACGCGGGAATACTTTTCTGCTCCTGTTT
CAGGATTCATTTTTAGGCTATGTGATGTGCAAACCCATGAGTTCGACCACTGCCCAAGAGGTTGCTGAGGCTTACGAGGAATGTGTGTTCAGGCGTTTCG
GAGCAAGTTCAATGCTGAGGCATGACCAGGATCCAAGGTTCATGAGTGAAGTTTTTACCCGATTCCGGGAAATGCTGGGTAGCAGGCAACGAGCAACCCT
AGCATATCGACCTCAAGCTAACGGCCAGCAAGAGCGGTCGGTTCAAACGGTAATGCGAAGTGTCCGTGCTTATGTGGCTGAATCAGATCAAAGCGACTGG
GACGATCACGCTGAACGTTTGATGTTTGCCCTGAACACGTCTTTTGACGCCACCCGGTTAGATACACCATTGTACTTGGTGCATGGTTGGTATGCTCAAG
GGACGGTGTCAGCGATGCTTGGACCCAAACCTTCAGGCGTCGTTGAACGTACCGCTTACGAGTGGCGTCGGAAGTTACAACGTGACTATAGTTACGCCCC
AGCCTGTGCCAAAGACCTTCAGATAAAGGCGAAACGACAGCGCTCAGAAGCTCAGACGGAGAAATGGAAGGAGTTGTCAGAGCGTCTCAAAGCTGGTTTC
AAGGTTGGCGATGCTGTATGGCTATACATCCCCAAGGTGCAGACTGGGTTGAGCAGGAAGTTGGCTCATATGTGGCATGGTCCGTTCAGGATAGATGAGA
TGCATGATGATTTCAGAGTCAAGCTGAGAGTCACCAACACTGGATATCGGGTCAACCCTTGGGTGCATGTGAGTCGCCTGAAACCGAGAGCTTTGTTCCT
GAAACGTCCAGTTGAAGCAATCGAGTTGGACGAGGATGATGATTTTGACACCGCTTTGTTACCCGAGGACAGCTGGGAGGCAGACAATCTGAACGACGAG
TTTGAAGTTGAGAAAATTCTGGATCTGCGTTGGAATAAACGCACTCGAACTGCACGACGCACACGAGAGTATCTCGTGAAATGGAAGGGCTATGAAGAAC
CAGAATGGTTACCAGTTTCGCAACTGAGTTGTGGTGCTCTCCTGTATGAATTCAATCAAGGAGCTAGAGCGAGAGCTCGCTTCAGGACCATGCAGGCAGG
AGATGATCATCCCAGAGCATAAAGTGCCCCGAGCACTTGTGCCTGGATGTAGACCGCTGACTTTGTGAAACGATTGAACCTGAAACGGATTTTCATATAT
GTACCCTGAAGTGATGAACATGCTGAACGTGAAAATGAGAGAAACCTGAAACCGGAATTGAAGAACGGATGACTCTGGGGCAGTTGTGACTCAGACGCGA
CTTTTGAAGAGAGTGTGACTTAAAAGAAATGGATTCCAGAATTGACAATGCTGAAATGCAGGTTGGAGTGACAAGTTCTGAAACGAGAAAAATGTATTCC
TGGACGTTAAGAGTACGACACTACTACATTCAAAATAAGTAGAGCGGAAGCAGCGTCCAGGATTTGCCGACTTGAATCGGGGCTCAGACTTCAGATTTCC
GTAGTTTCTGTCTTTTCGTCATCATCCACGATCTCGTTGTCAGGATGTCCTGGTACGATCCAGTTGAACGCACGACGCGGAAGTGGGATAGTTCGAGCAC
GTAATTTCGCGGGGATATGCTTGGTTCGCTGAATCTCATTTGTTGCTGAAACCCAAAGTGTGCGCTCAGGCTCCCGTTCGTCCACCTCCATCAACTGCTG
GCGGGGAGGCTTACGTTTGCCGGTTTTATCGACGGAGGGAGGGTCTTCCCAGATCCAGTGACAGACACGAAACGGGCCAGATTCCAGGTTCCTGAAGCAG
AGTCTCGGGGAAGCCTTGAATCTTCATCAGACGCTGGACCTCAGTGCGATGTTTCCGCATCAGCGAATCTGTTCTTGAGCGACGTCCGTCATACAAGACT
TGAGACTATTCATCTTGGTCCGGGTCAATGGTGATCCAGTGAAGCAACTCCCACCCAATCTGACTGTGGTCTTCCATGAAGGACACGAATTTCTTCAGGC
CGGCCATGATTGCAGGGCCCAGCTTGGAGGCTTGGTGATAGTAGAAGACCTTGGTGCGTTCAGCAAACATGTGTCTCCACGGGAGCTGTTTCTTGATCCA
GGATCCGTTCTTCCTTTTCGGCAAGAGGCTGTCGTACAAGTCGTAGTTCCAGCGTTCTTGAGCGTACCGAATCTCAGTCTTCTGTGGAGCGTAGTTGGGG
AAACCTTGAAGCTGGGCCTCGCTCTTCTTACCGAAGAAGTATATCTTGATCCCGAAGTACCTGAACAACGACGTGATGTTTGGATCAACAATCTCGATCT
TGCGAAGCTGCTCCAGGCTCAGATCTTGAAATGGGATATCAGCCAGAGGAGTTGAATCTCGACTACTGAAAAGATAATTGGTCTTGGAGTTCAAAAGCGC
TTTCTTGCGCGCAGATCCCGAGTGAGAATTGGAGTCCTTGGAGCGCTTATTCTGCGAAGAACGCTGAGGGGTCGAGCGAGGCGCTGAATCTTCTGAATCA
GAACTGGACAAGACGGTTAGAGATTTGGGTTTCTCCTCGAGAACGTCGGTCTTGAGGTATTCCACTTCAGCTTCGCCTTCAGCGTCGTCAACCTCTTCCT
CCTTGTCAACAGTCTCAGGGTCGAACGGAGAGTCGCCGTCGCTGCTACTCTGGTCCGAATTTTCAGGAATTAATTGGTCACACACCACTTCGACGAGAGG
ATGCCAAGGCTCAGGCTGAAGGTTTCGTGCAAACATGTGCTCCAATCGAGTTTCGGCGCGAAGGAAGTACATCTCAGGGACGTACTGCGTCCAAGGAGTT
GAGTCCAGTTTTTCGAAATAAATCATGCTCACAAGCATGGTTACGAGAGGCTCATGATGGAAGACGGGGTGAACCACCTTGTTCCTGCTCACAAACTCAA
CTGAGGTCTCGTAAGAACACCCGGTGAGCATAGTGTAGCGAACATCCAATCTAAGGCCGTTCCAAACTACACCTCCCGGGAGATTCCCGCGTGCAACTTC
CTCCGTCCACTCCAATTCCTCAGTTCCAGAATGAGTATACTCCAAACACGGCAAGCGAGAACTGGGACGTAACGGGAATGAGTCCTTGAAACTGATCCAA
GACTCTTTCGCTGCAGACTTGCGAGTCTTCTTCGGTCGTCGAGATTCAGGAGTCTGAATTGAATTTTTGGAACCCTTGGACTTGAGACCAGAGTGAGACA
AATCTAAGGTCTTGGGCGGAGTTTTCAGCTGAGAGTCTTCATCGTCATCATCTCCAGCTTTCTTGCGCTCCACCACGTAGTCCCCAGGGACGCACCTGGG
ATCGTCGACGGCGAGGACGTTGATGTTTGAGATCCACGATGAAGGAGGCTTGGTCCGTTTGACGAAGTGCTCAAAGAGACCCTGACGTCGTTGCCAATTG
GATGTGATTGAGACGTTTGGATCTTGGTTCAAGAAATCGGTGAAAGACCACGAGCTCAACTTCTTCTCCATCATGTCTCGACGCAGAATTTCACACCGAG
CCTCAGATGTGTTCAGTTGATCTTGGAGCTCAGTGATCTTGTCATCACGCTTGTTCAGTTCCAGCTGGTGCTCTTCGGGCATGGATCGGATTGAGGCTTC
GAACCGCATCTCAGCATCATCCTTCTGAGCGGACATGTGTCCCAACTCGGATTTCCAGTATGCCTGCATGGCGGTCCACTCGCGTTCAACAGCGTCAACC
CTGGAACGCAACTGGAGCATATCTTGAGTTGGTTTGTTGTTTTGCTGGAGAAATTGGGTACGAAGATGACGATATTGCGAGAGAAGTCGTTTCAAGAACG
AAACCATGTTGAAAGTTCGTTCAGCCAAGCGATCGGTCCGAACACCCCCAAGAGCGAAGCCATTTCTCTCTGCACTGTGAGGGCACTCAACATGCTAACG
AGGTTGGAGATCGAAGGAGGCCTAGAGACAACTTTCAGAGTGTTCTGAGCCGACCCAGGACCCAAAAGCGGTTCCAAGTCATGCATGCCAGCGCCGCTGA
GGGTCTCAAGCACTTGAACAGCCTCCAAACCTCCATATCCATCACGAAGATGGACACCATGACGAATGGAATCCTCAGTGGCAGGAACCCCGACGAGACG
CATGGGGACATCCGCATCACAATCAGGCGGAACCACCCAGTTTGTTGGACGCTTCATCTCGAAGTCTATGTAGTCAAAGCTGGACGACGGCACGAGCTTG
GAGAGCGAAAAGCGGGCGTACTCACCGCGAGTTAGCTGGCGTGGAACCTTGTTGACGAAAGAAATCAATGCGCCAGACCGCCGATTACCGGTGCTCAGAG
AGAGCGGAGTTGAATCAGAGCTCCGCCCCTTGTCATCATCCGCACCAGCGCTTGCCTCCGCTTTGCGCTTGGACGCGGCCTTGTCTGATGCGTCGCCAAG
GTTGTCTGAAGCTGCGTTGTCGATCTCCGCCGTCCGCTTCAGCTGAGTGTCTGCCGATTCCTCCATAACGACGTCTCCATCACGCGAAAGGTTGTCGGGA
GCACCATCCGCTTCTTGCGATGCACTAGGCGTGACTGAAGAAATGAGCGCTGTGGTGTGACGCGGCCCAAGACGAAGGTTGCTTGATGCAACGAGAGGAT
GTGTTGTTGATCAAGTGGAAAGTTGGAATGTGAGAATGGCTGTGGCTAAAGGTTGGCCGCAAAAATGAGTTTGAAGGTTTTGGACCCGGAGCGAAAGGGT
GAGAAAGGGGCTGAGCCCGCGCAAGTTGCTGAGCAACGGTAAAACCACGTTCAGGCTTAAGCCTGCTCCTATCAGTTCCAGACATGGTGCCTCTCCTCGG
AAAGTTCCTCTTTGACAGACCATGACCGGAAGGGACGGTTGAGTGCAATTTCTCGGTTGGAATCAATGGGTGACTAGTGACGTGGATATATGCTGATATT
TGATTGGATGCTGAAATTTTTGAGTACTGGTTATGCGCATTGCGCATGTTGAATGTGGAATTCGGCTGTGTTCCGCGGAGCGGATGCACTCAGGCTTTAA
GATGGGCCCCCCAGATTTGGAAGGTCAGATTAGGCTCCAAACAGCCTGAAACTGGATCTATGTCTGAATCAACCCCGTCCTTAAGCGGGGTTAACCCAAT
GGAGTTGAAAATGCCTATGTGAATGTATCACATATGGTGTCCCGCCTTGCCTAAAGCCTGAGCGTGTGAATATCCGTGTACCCGGAGTGCACCGTAAGTC
ACCAGACGCCAGACAAACAAAAAGCCCGTTGAAGAAATGCCGTGTGGACCCTCACAATGAAGTATGATTTTGGTCATGAGACCTTGATCACATTAGATGT
CTGAACGCAGATGTCTGAACGCGGATGTCTGAACGCATGTATTATACGTGCTCAAGACTATCCTGTACTGTGAGGTCGTACACACTGGTTTCAGCTAAAT
GTCCAAGTTGAAGAACCCTGAGCGTGAGTTCGAAGTATCTACGTTCAAGGAGATTGGAACCTGAAAATGATGTTCAAGGTCAAGTACTTGAAAGTAGGTT
TAAAGAACCCACGTTCAGACAACCCAGAACCCAATGCGAGGATTTGACTCCTTGAAGATGGAAAGTGAACCCACGAAGTGACAGCCAGTATACTCAAACT
AAGTCAAAGTCAGAAGGTCGCTATGAACGCTATGAAGAACACAGAAGAACACAGAAGAACACAGAAGAACGAAGACAGACAGATACCCTTTACGAAGAAG
CTAGCGATCGGCTAGCAAAGATAACAATCAGAGTTCGTTTAACCCCCTACTACGCAAGTCGCTCAAAGTAAGTGAGCTTCCGACAAGCAGGACACGGGTC
CGCCGTTCAGTTAAGGGCAGTTCGGTGCGGGGCTCTCTACAAGATTCAAGCCCAGTTGCGAGGGGATCATTCACGTAAGTATTTGACGTGATCCTTGCAT
TCCTTTTATTAGTTGGACCCGCTGCGCGTACGGTAAGGGCGGGGTTTTCATTTCATATTAACAAGGCCTTCTTGGGTGATAGTAGCAGTCATCCCCAGGA
ATATTTGATAGACTGCGTTTGAGATAGGATTGTATTGGTGTGTATTATTTCCCTCATCTGAGGGTGGTGCGCGTGTGAGGAAAAGGCTTCAGGATTGACC
AGTATCCTGGGTTCAGCCTCAGTTGACTGGTGTTCAGACCCACCGTTCAAGGATCTATAAGAATAAGTAACGGCTGTGTGTTGTATATAACTCTGTATTT
GTATTGGGTATCTGAAAGTGGTGTGTTCCGAGTTCTCAATACCGGTTCCAGACATTGGAGAAGTACATTCAGGAAGTGGACGTTACGCTCAGCATCTTCA
AGGCCTATTTGTATTTGACAACTCATTGTGGTGATATATCCGAGCTTCCCCCGAAGCAATCGACGCCGATAGGGATTACACAAGGTGCCACGCCACTCTG
AATCACGGTTTCAAGGAACCGCGTTCAGGGTTTACACCCCCCAGGCTTAAGTTTCAGGACTAAGTCTAGGCTACCGCTATACACTTGGGCGAGAAAGTTT
CACCGACTTCGTCACAGACGGCTGCGAGTGCTTTTCTCGAGACCACCACGGTAAACCTCGCTGAGTATGCTGGAATGAACAACGGCGTCTCGGCTGCGCT
CGAACATGGAGCCGAGGATTTAGTCATCGTTGGCGACTCGAGACTCGCAATCCAGCAGTCCCTAGGGGTGATGGCATGTCGAAAGGAATCTCTGATGGTA
CAACTGAATCGTCACCGAGAACTCACGACCAAGCTGCGGTCAGTGAAGTATTTGCACGTAGTCCGAGAGTTCAACGCTGCGGTAGATTCGTTGGCAGGCG
AGGATCTAAGCAGCAAGGAGTCCAGTGTAGCTTCGACTGAGGCTAGGATATCAGAATTAGTCGAGCTGAACCGGATCGGGGAGGTCATTTATGAACCTTC
AGTACAGACCACGGCCGAAGAGAAACAGGCGGTGAACTTCGACCGAGCTCAGGTAGCCCATGGAACCTCTCGCGACAGATCTTTTTTCGACTTTCTGCGG
GACGAACCAGACTACCTAACTGCAACGACCAGACACCAAGCAAAAGCGAGGAAGAAACGAGTCCAGTTTGCGGATGAGACTTCGGTACTAGGCCCGAACG
ATGCGGCTGAACGAGACGAAGCGAATGGTGTGGCCACCGAAGCTCAGAACGAGCGGAGAGCCGAGCAATTGAGTAACGAGGCGGACCCTGGCGCTCCGAA
CGCAGAAGACGTTGACCCTGTGGTTATACAGGAAGAGTGCCGGCGACGAATCTCCGCCGCCCAGGACGAAGAGCTGAGATGGTCGAACCTAAAAGCGGTC
CTCCGAGGCGAGGAAACAGACCTAAGCTACAGAGCAGCCAGAGACGCTTGGAAGATGGCCGACAAGTTCGTGCTTAGCAAAGGTGGTGTACTGTATTTCC
TTGGAACGAACCGTCGGTGGGGCAACGAACGCCGAGAGGAGACAACGATACGTCTAGTGGTGCCCACAACGATGATTCAGGAAGTACTACGGAGTTGCCA
CGACTCGTTGGAAGGTGGCCACCAAGGTATCGGTCGAACTTACCACCGAGTCAAATCGGACTATTTTTGGATTGGACTATATGCAGACGCCGAACGACAC
GTCAAGTCCTGCCCCGACTGTAGTTCGAGCAAAAGTCGACCACAGTTCCGAGGCTACTCGCCAGGGAACGTTTTGGCAGAGCGACCGTTCCAGATGGTGT
CGATGGATTTTGTCATACCGTTACCGAAGTCTCGTCGAGGCAATTCAGCCTTATTACTGTTCCAGTGTGCGTTCACAGGATTCGTCATGGGTAAAGCTAT
GTCGGACACTGCCACTCTGAAAGTCGCACAGGCTTTCGAGGAATGCGTGTACCGAAGATTCGGAGCACCAACTCTAATCCGACATGACCGAGACCCTCTC
TTCATGAGTGAGGTGTTCCCGGCCTTTGCAGAGATGATGCAGTCTCGGTCAAGAGCGACCCTGAGTTATCGGCCGCAGGCGAACGGACAGCAAGAGCGGT
CAGTGAAGACAGTCATGCAGTCGGTGCGAGTGTACGCGGAAGACCCGCTACAGCAGGACTGGGACGAGATCGCAGAGCGGCTGATTTTTGCTATCAACAG
CCCTCAAGATGGCACACGAAAGGACACTCCGTTTTACCTAGTTCATGGGTGGGACGCACAATCCACGCTGCGAGCGATGTCTTCGTCACTCAAACGAGGA
TTCGGAGGCCAGGCTGACGCGTTGGCATGGCGCCGAGAAGTGAATCGGCAACAGGAAATCTCGTGGAGAATGGCGATGGAGTACCAGCGTGTCGAGTAAG
CTCAGAGAGCAAGAGAGCACAATGAGTCGCTGGAGCGGCGCGAGAGAGCTGCAGTACCGAGTGTCGATGAAAACGAGACTTCTGACGAGTAACAGGTGGA
GACAGGTGTGGTGTAGGGAAACTCATATTTTGGGTAGACCACCCAGTCTGGCTCAGTTAGGTACGTCGTACCTAATCGAAGTTCCACCTAAGCGGCGAAC
TCAGCGAAGCGGTCGGACTCGGCGAGCATTAAGACTCAGCGAGCGGCAAAACTCCGCGAGCGTATTTCATTTGTGAGTTATTCCAAGTGGGAGAGGATAA
GCCAGGGATCGGAGCGAAGGGTCGGCGGAGATCCATAACGACCCGACTCGACGAGGATCAATTAGGAAGCTGAGCGAAGAGTCGCAGGGAGATCTATAAC
GATTCCATTTCACTAGATATTTGTATAGGATCGATAGGAGACCAAAGAGGGGAGCCCGAATGGACTCCCCGAAGACACAGAGATAACAAAACAGAGCAGA
ATCTTCTAAGCCCAAGAACAGCGTACGCTTTTTCCGGTAAGCCCCTGCGTGGGCTGGATTATGTCTGCCGTCGTTCCCCGAGAGGCATAGCTTGTAGGGG
AATCGACTGGTAGCGCCAAGAGATCAAGGTCGGCCCGGGGTGGGCACTTCTCGCTACCAACGAAGACAAACCTCGTCGAATCGACGAGCCGGTGGGTCTG
CACAATCCAGGACACCGCAATCTTCTAGCTGAGCGTACTCTGCGCTTGGTGGTCTGTAAAAGCGCTCGCGCGCCAACGTCCATCCTTTGGTGGAGGTCAC
AGGGTTTGAGGAACGGAAGCTGCCCCGCTCAGGCGAGCTTCTGGAGTTTGGATTGGTACTCAGCGAGAGCAGGGCCTCAGCTGGACCCGGCTGGGCCGAA
CCGCAAAGGGAACCAACAGAACCCTTCGCAAGCCCAACAACGCCGACCTGACTCGGCGAATTGTTGTGTTGTTGCGTGGAAGCCGCACTAACGAAGTTTT
TGTGGATCACAACACCACAAATACCAATTGCTTTATACGCGTTGGTACCCAGCGCAACTTGTGTCACGATATTGCCAACTCCTGACCCGATATCCACGAA
AAAATCATGTCCATCAAGCGGTCCAAGCGCTTCCAACAACGTGGTGACCCCTTCCGGCAACATTTCACCAGCATTACGTTGTGGATCATTGAAGTCTCGT
GTGGCCACTTTGCGAGACACAGCCGCAAACAAACCAGACACCGCTTGCTCAACAGATGAAGGAGACATCGCTGGTGACCCTGGCGCCATCGATAGTGCCA
ACGAATCGCTCGTGGGTTCGTGAGTACTTGGTTCCTCGTCAGAATCTTCAGGGGGTGATGCGGGAACCGGGAACTCCTGCGGAGGACTACTTATTACAGG
TGCAGTCGGAGGGCTTCTTGGAACTTGCGGGATAGCAGGTTGTTCGGGAGGCTCCGGTGGTACGTGACTGTCTAGAGATGGTGTAGTGATCGTAGTAGAG
GCCAATAGTGCAAGCGATCTTGGTGGACTCCTTGTAGTCGTATGATTCGTATCTTGTCCAACAGCTTGCTCACGAAGTTGACGCATTACCGCAGGCGGTT
GTCCACGGGGCCGGCGAACAGGAGTTGAGAAAGCTCGGCGGAAATCGACGTAGGTCATTACCCCAAGTTCGCATTAGAGTTCTCAAGCGGTGCTGGAGCG
CTGTGACAATGTGCTTTGTCCGGCGCATGTGATGCGCTACATCTTGCCATGAAATGCAGGCCCCTCCTTCCACAAAAGCACGCGCGCGTTGTGCCAATTC
CTTGTCGTCTTCAAAACTGAAGCTTGTACGCATGATGCGCCGAAATGAAAGATGCGCCAAGCAAAGCAAATGACCTCAGTTCACTATCAAAATTGAAAGA
TGCTGACTGATACGTGGTGAAGGGAGAGATATGGGGAGGATGGGGAGGACAAATTTTTGGACCTACAACGCCACGTAGGCTGTGTCACGGACAAATCGCA
CTTATGCTGCGTTTTGGTTGACGCAATCTCGCCCAAACTCGGACTTAACTGCATATTTTGCAGTGATGTTTGCCACATAATGCAAACTATTCAAGGGTTC
GGGGAGACCGTCATGCCAGGCAGGCGATGTGATTGGTAGTAACAAAAGTGGGTTGGAGCTTGGCTGAACTTCTGTCAAGGGGGTCATTTTGACCCCCTTC
TTGGCCACTTTCCTCGCAGGTTTTGACTCGAGCATCAAGGGGGTCAAAATGCACCCTTTGTTCGCGAAAGGGTTAAGCGTCCTAATTTCTTGCTACGTTT
TCTTTCATTTTTGGTACGACTAAAAAATGTGATTCATCGCATAAACATTTTCGCATACAAAATCCAAGTGACCCAATTACAGTAGCGGATCTACAAATCA
GGCGATGCTGTCACCGACGCAGAAGCTGCCCAAGGCTCGCTCAGATCCCTCCGACCCAAGCGATCAGGTTTACCTCAAGTCCACGTGGGTGGTCACGTCG
CTGCGGCATCCGGCGCTTCGGGTGTTGTGCTGTCTGGCTCACTTGGTTCTGTGCTTCATCTTGGGGGTCACCTCCCCTCTGCTGACGTCGCTCAAGAGCC
CCGCCAACTTCCCAGTATACGGGGATCTAGTGAAGGCAGCAACCGCAGGCTTTACATGGCAGAAACTTATCTTCCAGAGTGTGTTGAGTGTCACGTTGCT
GCTGTTCCTGAGACTTGTGGCATACCCGCGCCTAGTGCAGCGCCAATGGAACTGGGAGGTGTCGTTCCACCACGCTACACAAACTTTTTCGATACTTTCG
AGGGCCTCTGAGGCTGACATGAATCCCCAAACAAACTTAGCAGGAGCTCGACTGGGAGTACTGGCAGTGCATACTTTCCTCTCTGGTAGTTCTAAAGACG
TCCCGGCGGTCCGGTTGCACGTCTGGAACATCGGGTCTTCGCATGGCTCTTGGACATTTATGGCTGCAATATTCCCCTTCCTCTGGGCGGCAGTGATGTA
TGCTACCAGAAAAATTGTTCGCGATTCTTCAATCCAGAAAATGTTCTTTCCAGAAGACCAAGATGAAGCCTGGACAGATCTGCGCCAGCTGGAGCTGCAA
AAAACTTTATCAACTACGCTGCTGACGCTGAGCTGCTTGAAGCTGTTGGTGACGCTTGATTGGGTA