Description :
From Genome Similarity Track
Location :
Scaffold_15:23432- 24841
Transcript NameFunction/comments
Phyra_75868Hypothetical protein

Sequence
1409 bases(100 bases per row)
TGCGACTCGATACCGGCCCCGAAGACTCGCTAACCGCCACCACTACAGTTGGAATCACCTTCACGGCCAACACGCTGCACTTTGCGTTCCCTCATCTCGT
CCACAATGGAGATCGAGATCAGTGGTCACCGGTTGCTGCCAAGTTGCTCGACCAGCGGTTTGTGCTGCGAGGCTCGATCCATTTCAAGTGGGACAGTATC
ACAAGTCGCGTGGAGCTTGTGCAGTCAAAAGCGGACCTTTTGACTCCGATGCTGCACTTACTGGGCGACTTGGAGACCGTCTCTCGCGTGTTCGCCAACG
CACTTGTCACTCCAGAATGCAAGCTTGCTCAGTAGGCAAGTCTTAAATGAACTTGCTCATTGTTTGCTCGCATGATAATGCCAGGCTTATAGCGAGTTTA
CAACGCACGGGCATGAATAATCGCGCGAATAGTTTGCAGCATGAGGCCAGGCCCTTTTTGCGATAAAGTCATACAGCTCAAGTAGCTCACTGTCCGCCAT
TTCCGACTCTGCGGGGCGCACCTTAAGAAGAGCAGCGCGACGCATCACCACCACTAATTCTTCGTCATCCTCGCTGCTGTCTTGACGTGCAGCGCTACAT
TGTGCGAGCTCTGGTGCCGGCCTAGTCTTCCCGGATTTCTTGTCGCGCCAAACTGGTGCCAGTGCTACAGCAGCAGTGATGTCTCGCCGAACACAGTTGG
CTGAATCGTACGGATACAAATCATCTTCATCCACACTGTCCATGACAGCCAATGCGCACGCCGAGCTCGTCAACGCGTTGTGATCTTCAAAATGCTGCGC
GAATGAGACGGTAATAGCCCCGGTAGTCACGCCACTATCGCAGTTCGAGATCAATCGGTGATTTAAAATGTGCGTGCAGTCATTCGGGCTGTCGTAGTCT
TCTCGAACCGTAATATCACCCAGCGCTTTGGAAACACTGATCTCCATATTGAACATGAAGACCGTAAGAGCGTCGTAGACTTGCTTGAGCGACTGGACAC
CGCAAAAGTGGACTACGTCGAACCGATGGCACGTGAAGTTTCCGTGTGCATCCTCGAATCGATCCTCAAAGAAGTGATTCTTTGTCATGTCTAAGCTGCC
GGATCGCTCCGTTAAGTAGCTGTAACACTGCATAAACTTCGCGTTCTTCATGCCAGTGAGTACCTCGCGTCGTTCACTGCACTTCTTGGGCAAAACCACG
CGCGTATACATCGGGTTTTCGTGCTGGTCTCGGAGGTGGTTGGAGAGCACGGATTGGGTGCAAGCCACTGTGAGCTGCTGTGTCCTCACTGCACTTTTGA
GCACTTGATTCTTCGTGGTTGCCTGCCGGAGCTTGAAATTATCGCTGCCAGTCGCTTCTTGGAGGGCCTTCAGTTCTTTGCGTAAAGCTTGCGGCTTCTC
CTGCAGAAC