Description :
From Genome Similarity Track
Location :
Scaffold_49:234288- 235998
Sequence
1710 bases(100 bases per row)
CGTGTGGATCGAGGTAGTTGGCGGTACCAGTTCCGCGCCGATCCAGACAGCAGATCCGCGAAGGTCAGGCACTTCTCTTCGTCAGGTGCTTGATCGCGGA
GGAACGCAGACTTCACCTTACTGACCCAAGCTCTCGCTCGATCCTCGTCTTGATCCTTGCCAGAGAACTCCTTCAGATCCGAGACCGCTGAGATCCGGAC
TCGTTGGATCATGTGGATCCGGTCGCGGTGGTGACTACTGTAGCGCGTGCTGGGGCCGGGAAGTCAATGTCGTCAGGGTCGAACTCCCAGTGTCGATCCG
GATCCGACGATCCAGTGGACTCCATCTCGACATCTCGGGATCCATGATTCTGAACCGCCCCCGGTGCCATGGCTGGGGTCAAAGCTCCCTGCTCCTTCAA
GAACCTGTTCATAGCTGCCTGGAAGAACGACTCCAACCTGCCAGTCGACATGTCAGATCCTGATGCCGTCGCTGTTGGATCCACTGATGGAGCTGACTGC
TTCTTGGATCGAGGCTGGGATCGGGGCTGAGGACTCGCTTCACGTTGGATCTTGGCTCGGGCTCGTAGCATCGAGGCTTCCGATGGTCCAAGTGACATGC
ATCGCGGCTCCGAAGAGGCGTCCGACCCAAGCTCTGCAGCCGAGACATAAGGTGACGACGTCCGACATTCTGTGGATCCTTCTTGTAGTGATCTTGGATC
CGGGATTGGGGGATCCGGCTTCGGCTGGATTTCGCCTACCAGCACCTTCAGCCGGTTGAACAGCATCTCCGTCGTGGCACGGAGTTGGATCGGATGGATC
TCGTACATGACGGATCCATGATGCCTTGGATCCATCCTGAACCGAGGTTTCTGGATCTTCGTCCTCCAGCTCCGGGGCCTTCATCTTCCTTCTCGTAGCG
GTCTTCTTCGTCTGGGTCTTGTCTGGATGGAAGATGTAGGGCTCTTGTTTCACTGGAGAGTCAGCAAATGCATACCGATCCTGGCCAGCCTTGGTTTGTT
TTGTTAGTGGATCTTGACTTTCGTCGCGATCCACCGGGGTCCTCGAAGGGACCTGTGGAGGAGGTTGAGGTTTCTCTCCTGGATCCATGTCTGGATCCAC
CTCGGTTCCGCCGACAGAGGTCCTCCTTGCACTCTGCCGATCCGTGGATCTTGTTTCATTCAGCAGCGTCGTCGTCGATCCCGATTCCGAAGACGCTTGA
TCCCCTTGTTCCTTCTTCACTCGAACTTCTTCTTGGGACTCACGGTGAAATCCCGAGTCACCAGAAGATCCGGGTACGCGCACCATTGTGGTGTAGCGGG
ATCAGCAAAATCTGCGAGATTGCCAATCCAACTTCCCAACTGCGCCCGAACACCGACTTACGGAGGGGGTCCCCCGATGATCCGTGATCTGTGTGCTGAA
CTTGGTCACCTTGTGTACCCGTCGGTAGGGCTGGATCTTGCTCCTCTGGTGTCTTCCGAAGCGTCCGAGCCTTGACGAGAGAACAGTCTGGGCGAGACGC
GGGGATGTGGGTGGAGCAGCGTGGAAATCTTCACTCTGCTCGCGGTAGTATTCCAAATCCAGTAGTCTTGTACTTAGATCTGGCGGCCTGGATCTGGATC
CGGCCGGATTGTTGCCTTTTGAGGTTGTTGTCCTTTACGTTGCCTTCACAGGTCTTCCTTGGTCGTGTTTGCCGCCTCCAATGACGGTGTCGTTGACAGT
TGAGACGAGA