Description :
From Genome Similarity Track
Location :
Scaffold_1660:2342- 5622
Transcript NameFunction/comments
Pytiw_DAOMBR242034maker-piw_contig_1660-snap-gene-0.5Prolyl 4-hydroxylase
Pytiw_DAOMBR242034maker-piw_contig_1660-snap-gene-0.7Serine racemase
Pytiw_DAOMBR242034maker-piw_contig_1660-fgenesh-gene-0.2Pseudouridine synthase, RluA family

Sequence
3280 bases(100 bases per row)
TATTGTTTATATAAAGGTAATTTTCGAGCGTGAGAATTACCCTTCAATAATGCGTACATGTGCCACAATCGCATCCGGCCAGCGGCGATGAAGAGCCTGG
GGCGCTGTCTCCTGTCGCGCTCACGGGGCTGTGATGACTACAGGCGAGCGCTCTCCACCGCGTCAACACACACCATAGGAGTCGCGTGGCCGCAGGCCCT
GACGCCCGAGATGACCGGCGAGCTGCTGCACCGTGGCTACACGGTCGTGCGCAACGCGTTCCCAGTGCCGTACCTGCGCGCGATTAAGCAGGAGATGGCG
CAGCTGCGCGACGCCGGGCATCTGTACGCGAACGCGACGCACATCCTGCTCAAGGGCGAGGCGCAACCGACGCTGCTGCAAAAGCACCACATCGTCGAGA
CGGAGCTCGCGCTCGAGCGCGTCCGCAGCGAGGCGCCCGTGCTCAAGCGCTTCTTTGAAGACGAGGTCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCCGCTCGAACAGGCGCTGCCCAAGTGGCTCTCGCTGAGCGGTG
CGATGGTCAAGCTTCAGTATAACGAGGGTGCTGGTGGGTGCTTCCCGCTGCACTACGACACGTACGGCGACGACGGTAAGTGTGTCACCGCTGTGCTTTA
CCTGAACGAGCACTGGCGAGAGGGCGACGGTGGGGAGATCGTGCTGTACCCATTCCCGAGCGAGCAGCCGGTTGTGGTCGCGCCGCGCTTTGGCGATATG
GTGCTCTTCTCGTCGCAGCAGATGCTGCACCGCGTGCTGCCGTCCCACCAGCCGCGTTACTGCCTCACGACGTGGATCTACCAGTCGCCGCCCGACACTG
TCGCCCGCGCGGCATACTTCAAGGCAATAACTTCTCTCAGTGCATCAAACGCTAGAGGCCAAGCTGCTACACGTACCGATAGTACAGACAGCGCGGCGTT
AACCGCCATGATGGAGAAAGTGCTCGCGTCGTCCTTCCGAAGACACCTCATCAAGCTCTTCTACGCAGACGAGTGGACGCGGTCGCTCCACGAGTCGCAC
TTGCCCACGGACGCGTTCCACAAGTACATGCGCACACACGAACAGGAGCTGCGCGTGATCGAGGGCGCGACCGAGCAGATGCTTCGCAACTTTCGCTCGA
AAGACGCAAACCAGCCATCGCGATTGCCCGAGACGTGTGCGCAACTGGTGCAGCAACTGGTGGCGGATGATCGTGAGTGGAAGGCAAAATTGCAGCCCCA
GTGGTTTTGAATACAAAGTCAAGATAAAGCACAACACCTTGGACACTGTGGTTTGTCGACAGTCGCTCAGCTCCAGATTGCCAGTCTCCAGTGATCGTAG
AACGTACTTACTGGCTGCAGCCCCTCGCAAATACCTTCCAGGTCTTGGCGTGCTCTCCCTGGATGTACAGATTGTCAGCGAGATTCGCGACGACGCACGA
GTGGTTCGGCAGGATGATCATGCGCTGTCCGATGGGAGGCGGCGCGATGCCCTCGACCTGCTTGATCCAGCCATGCTCCTCCGAAAGCTTCGCCAGCTCA
AAGCACGTGACCTCGCGACCGCTTTCCAGCACGGACTTGTTCTGCTTGGGCATTTTCTCCAGATGCTCAAAGTCCTTTTCGTAGAACGCGAGACCGAAGC
AGCTGGTTCCGAACGCGTCGCCATCAACAGCGCGTGGCCTAAGACAGAGGGAGCGAGCGAATGGTACCTGGACATTAGTGAACCAAAAGAATGGCTCAAA
ACCAATTTCCACAAGGTTACGTACGCGTCGGAGCTGAGCACCTTGGAGCCGGCGTCGACGATGAAGTAGTGTTTGTTGGAGCTCACGACGGTCACGAGCA
CACCCAGCGATACGTCTTTGACCGAGAAAAGGCCAATGTTCACGGGCGTGCGGTCGAGGAACACGTAGTTCCCGGGACGAATCTACAAAACATGATACAT
AGTCCCTTAGTCAGCATTAACCCACACATCTTTAGTGTATGTTAAGGAACTTACCTCGGTGATTCCGACAAAGCTCTTGCGCGCGGGTTCAGTCAAAGTG
CTGCCAACGGACACGACCGGAACCGCGACTCCGTTCTACACGAACAATATAATAAGCGCTACAGTGAGCAACACAGTCACCTTGCATAGATAAGATAATT
GTAACCTTGTTGCACCTCTTCCAACATGCTCTTGATGCGAATGAGGGTGCTGCGCTCCGTCTCCGCGATCACAGCACACTCCTCCACGTTTGTGCTCGAG
TAGGCGTGGCCTATAATAACAAAATATAGCTATGCATTAGCATTTCATCAACACGCATGTGCCACATTAAAAAAAAAACAACGAGACGCACCTGCGTGGG
AAAGCAGTCCCGTGAACACGAGGTTTGGGGATTTCTCGATGCGTCTCGCGAACTCGAGGATCCGTGGGTCGCCCTCCTCAAGCCCCACGCGGTGGTACCC
GACGTCGATGTGGATGAGCACATGGACCGTGTAGTCGCACGAGTTGGCCGCCTTCTCGACCGCGTCGATGCCGTTCACGCTGTCGACCGTCATGCGCACC
TCCATGGCGAATTGCTGCGCCGCGACGAGCAGCTTACTCACCTTGCTCGTCTGCACGACCGGATACGCGACGAGGATACTCTTGAGCTTCGTGAGTCCGC
TGTGCAGAAACTTGAGCGCCTCCGAGGGCTTGGCGACCGTGATGCCGCACGCGCCGGCCTGGAGTTGCAACGCCGTGATCTCGACGGTCTTGTGGGTCTT
GACGTGCGGCCGCAGCTGCACGTGGTGGTCGTTCGCGAGCTGCTGCATGCGCTGCACGTTATGCAGCAGCCGCTGCTCGTCCACGACCACGCTCGGCGTC
GCCATCCACTCGCGCATGATGCGTAGCTCTTGACAGGCGGATCTTTTTGACTTGTGACTGCCATTTTGGCTCGTAAAAACGTGGTTGAAGTACGTTACAC
ATAGAAAAAACGTCTGACCTGTCAAAAACGATTTGTGCCAGTTACGATTGATTTAGAGAGGGGAAAGCAGGTGCAATCTTCGAAAGTGTGTGCCGAAATG
ATGACCGCATTGGATGCGCATGGGCAGCATGAGCGCTCGGTCGTGAACTCGTCGGCGTACGGCTTCTGCGTGTTCACTGC