Description :
From Genome Similarity Track
Location :
Scaffold_155:23415- 24669
Transcript NameFunction/comments
Pytul_var.sporangiiferummaker-pug3_contig_155-snap-gene-0.29Dicarboxylate/amino acid:cation
Pytul_var.sporangiiferummaker-pug3_contig_155-snap-gene-0.18Amino Acid-Polyamine-Organocation (APC) Family

Sequence
1254 bases(100 bases per row)
AACACGCGGCCGGGTAGATTGACGAGGTTACTGATATCCGTCGAGACCTGCAAGTGCGAGAGCAGAGCGCCGAGCGCTGTACCAATGATCACACAAACGA
TAATCTGCGTTGTCGGTTTCTTTAGGAACCTGATAAACCGGTTGTCGTCGTCGTCCGGGTACGCCATGCCGTTGTCGTCATTCAGTTGCCGGAGAAATCG
TGTGGGGGTGCCTGCAGCAGACTTGGATCCACGATGAAGAAATTTTCTCGGGTATGAGTAGTTGTCTTGGTAGTAGACTGCTGGGGATGCGATTGAGTCG
AGTGGCGTCGTCGAATCATCAATCATAGTCGGAACCGAGCCATCTCGATTCTCATCTTCGTAGAGAACGACACGAGGCCGATCCATTGTTTTCTCGCGGC
TGTATGAGCTCGCGTGCAGAGACTCACTCACACCTTCAAGACTGGACGAAGACGACTGTGGATCCAACGTGACCTGCTGAGCCAAGAAGCGTTTGCTCTC
AACCACGGTGACTCTTCAGATGACCGAAACTGCAATGTGGTAGTACTGAAACCCAAACTTGGGAGTCTTTCCGCGGCGCTGAATGATGTGCTCCTGAACT
TTAGTGGTGAGCGTGCGACGACCAGAGGTAAGCAATGCGCGGATCTTGGACGTAGCAGGTTCTTAGTGGGCATTTCTCACGATCTAGGAATATCCTCATT
TTCATCGGGTGACGATGGTCGATGCAGCCACTAAGAAGGGCGACCTTGTCTGATCCAACGTTCACATTTTAAACCCTGGATACCAAGACACCTCAAGTGC
TGATCCAAAGCAAAAATAGATGGCATGTAGGCAAGTGAAAATGGAGAACACGGAGCCCGATCGCTGGCACAACCGAATTTGCAGCGATGATGGGGAGAAA
AGAGCTGCAACTCGATATTCCATGCGATCTCGTCGCTGTGAATGGCGTCGACGCGACAAATCCCGAGTGCGCAGTCGATACCCATTGCGGCGACTTCACT
TTGGCGCTGGAGTCCATGAAAAATGAGACTGATATGCTTGCGTTTGGCGTGGAGTCACCGAATCGAGTGCGTCAGCGCCACATTCATATCCATGTCATTG
ATCGACGGTTCAAGTACCCGACGTGGATGCACCCGAACATTGGCGGTGAAGCGCAGCATCTTCAAGGCGACGAAGACGAGATGGCAGAGATCCGGAAGAA
GATGGATCAGGGCAGCCACAACCTTTCAGAATGGACGGCGACCGCGATCAGTGG