Description :
From Genome Similarity Track
Location :
Scaffold_80:234138- 235148
Transcript NameFunction/comments
Sapdi_VS20SDRG_14932hypothetical protein

Sequence
1010 bases(100 bases per row)
CCATCCAACTCGAAACAACAGCAAAGATAAACATAGCATGGCAGAGAGAGTCGGATCACGTCGGTGCTGTCGGCTGCGGGAGGTGATGGGCACGAGCGAC
GAGGCGGCGTCTCTTGGGTGTCTACCCTGCATGATACTTGCACTAATCTTTGGCACCAGTACCGGTACTAGTTGGCACTGAACTTGATGAGGTTGCACGT
ACCATCTGTCGTGGCCCTTGGTCGTCCCGCATAGACGGACGGCCGTGGTGCGTCGTTCGGACAAGTTCTGTCGCGGGTCGCTCGGTACGTTGGCCCGCCT
CTCGAGGCAGACAAGGCTTCGTACGTTGTTGAAGATGACACCGGTGGGCGTCACGGGATCGTGGCGGCTGGAGGCTCATCACGAACAAACTGGTCGGACG
GAAAAGGAGCGAATCCTTGGCCCAGTCACACGAACGCGGTGTGCGCGCGTCGCAATGCAGAAGCTTCTTCCTTCGATGAGCGTCGTTTAGTAGATTGGTG
GCTCCACCAAATTGGAATCGCACACGTCTGTGGGACACGGCGTGTCCGATCAGGATAACGAGGCTGGTGCACATATCAGATCTGATGCTTTCGAATGGGT
GGTTGGCCAGAGTGCACCGTTGGAACTCGTCGACCAGAACCTAGCTGGCAGCTGATTCGCGCGGTGGTACGGCGCTTGATGACGAAGTCGCTAGCAGCTG
CGGTTGAAAGCCGCGTGCATAGCACGCGCGTGTATTCCGAGGGACGAGCACGCACCAAGGACAACCAATATGATTGCTATTTCGACAACTATGACTAGGG
AAAAGCTGTTCCACGGGATGGCAGCTTGTACGTAGACACTTGGGGCGCTGGTTTGTTCTAAGCACCAGAGCGGGTCGTGCACCAATTCTGGCAAGCAAGC
AAGCCGGTGGGAGGATAGTAGCAAGAACTTTGTTTCGTGCAAGAACCGCTGTTTGCTCAATCACGACAACGCCGGTAGTATCTCTGATACCACAAGTATC
TACCGGCAAG