Description :
From Genome Similarity Track
Location :
Scaffold_80:234127- 235277
Transcript NameFunction/comments
Sapdi_VS20SDRG_14932hypothetical protein

Sequence
1150 bases(100 bases per row)
CACCGTCGCTGCCATCCAACTCGAAACAACAGCAAAGATAAACATAGCATGGCAGAGAGAGTCGGATCACGTCGGTGCTGTCGGCTGCGGGAGGTGATGG
GCACGAGCGACGAGGCGGCGTCTCTTGGGTGTCTACCCTGCATGATACTTGCACTAATCTTTGGCACCAGTACCGGTACTAGTTGGCACTGAACTTGATG
AGGTTGCACGTACCATCTGTCGTGGCCCTTGGTCGTCCCGCATAGACGGACGGCCGTGGTGCGTCGTTCGGACAAGTTCTGTCGCGGGTCGCTCGGTACG
TTGGCCCGCCTCTCGAGGCAGACAAGGCTTCGTACGTTGTTGAAGATGACACCGGTGGGCGTCACGGGATCGTGGCGGCTGGAGGCTCATCACGAACAAA
CTGGTCGGACGGAAAAGGAGCGAATCCTTGGCCCAGTCACACGAACGCGGTGTGCGCGCGTCGCAATGCAGAAGCTTCTTCCTTCGATGAGCGTCGTTTA
GTAGATTGGTGGCTCCACCAAATTGGAATCGCACACGTCTGTGGGACACGGCGTGTCCGATCAGGATAACGAGGCTGGTGCACATATCAGATCTGATGCT
TTCGAATGGGTGGTTGGCCAGAGTGCACCGTTGGAACTCGTCGACCAGAACCTAGCTGGCAGCTGATTCGCGCGGTGGTACGGCGCTTGATGACGAAGTC
GCTAGCAGCTGCGGTTGAAAGCCGCGTGCATAGCACGCGCGTGTATTCCGAGGGACGAGCACGCACCAAGGACAACCAATATGATTGCTATTTCGACAAC
TATGACTAGGGAAAAGCTGTTCCACGGGATGGCAGCTTGTACGTAGACACTTGGGGCGCTGGTTTGTTCTAAGCACCAGAGCGGGTCGTGCACCAATTCT
GGCAAGCAAGCAAGCCGGTGGGAGGATAGTAGCAAGAACTTTGTTTCGTGCAAGAACCGCTGTTTGCTCAATCACGACAACGCCGGTAGTATCTCTGATA
CCACAAGTATCTACCGGCAAGCGACTTTGGCGACGAGGCTCGCACAGTTGGACGTTGCTTCTTCTTCGTCGCATGTGACCAATCGTGTAGCCATACCGAC
TGTAGGACATCGTCCGACATCAGCCCTTCGTATAGTAACTCAGCACGTAG