Description :
From Genome Similarity Track
Location :
Scaffold_1382:2341- 4115
Transcript NameFunction/comments
Phymu_g13197hypothetical protein

Sequence
1774 bases(100 bases per row)
ATATACATTTTTGTCTGGATGATGTTGATTAACATGTAACTAACAGTTCTGTCTGCCCTGTAGTTGTTCGTTGCGTTGGAGATTGAAGGACTAGTGTAAA
CTTGGTGTGCTTCATGCGTATCCTTGTTGTTCTGGCCCTCGCAAGGTGCTGTCGTCCGCGAAGACTTGGTGTGCACCGCTATGCGTAACCTTGTCGTGTG
GTGCGACAGCAAGCAAGAGCAGGATAAGAAGGACTCTGTATGAAAGGTAatacaagaagctgaagataTTACGATTTCTCTGTTTTATTTTGCTGTTTAG
GAATCCCTACCACGACGGAGCCGCCGCAGTGGACGCCTACTGCTGTAatctgctggagttgttggCGATCGGCGACtacctcctgcttcgtcctcaatgA
AAGTACGACGTACGAGGGCacggcggcgacgatgaaAAGCGCGGACCATGGCGGGAGGAAAGTTCGTGGCAGGTTCCTCCGTTGCTTCCCAGTCAACGAG
GTAAAGGCGAGTGCCTTCGCGGACGAAAGAGTCCTGTATACGGCGCACGTCGTACAGGCGCGGCACTGCGAGGCTAGTCGTCGGTTGCCACTCCGtctcg
ccgtcgctgctatCGGACTTCGCCTCCCCGGAAGCAGGACCAGGTATCCAGacaacgtcttcgtcgctgccatcTTCGGCAGAGTGtttctcttcaacag
caggTGCCTCCAAAACTGCAGGAATTGGCTTCTCTTCAgcgacaagcagcttctcttcagcgGCTCCTTCTGCGGTGGgcgccttctcttcagcagcggg
TGGTGCTTCAGCGGCAAGCGGCTTCTCTTCGGTGGTGGTTTGTGCTTCGGCGGCAGGCGTTGAGGCTTCACCAACTGCGTCACGTGCACCTACCAAGGAC
TCGCCTGTTGCCTGTGCGGATGCcgcgtcgtcttgatgacGTGCGTCACGCCACAGACGGACGTGAGAAccttcaagacgacgcggttcaagttgaagca
agcaGCCAAAAGCAGAAAACAAGAAGCCCGTCGGCGTGTTACCTAGGGACGGAACACTGTTGTATTCGGCGCGCAGGTAGcgtactgcttctcctgaGAT
TCTGACATGAGGGAAATACTGACGTATAAATGCACTTAATGCTTCTTCGAACTCCTTTTTACTTAGAGACATATCCACTTACACAGCAAATAAGAGAATG
AGTAAGTGACTTGTACTTCCTCTATATTTAGACAATTTAAAATCTTTGTAACGGTTCTCACAACTATTTTTGTGATTTTCAAGTTCTTGTTTTAaataga
gaagaagaaaacgccaGCAATAATGGCTACCCGCAGAAATGCATTGACGATTGCTACGCCACTAAAAACATGTCATTGGTTTCTTCAGGGGCAGAATCTC
TGATTTGGCCTACAGCTAGGCGAGCACGAAATCCAGATATAAGTTCTTTGAGTGCTCCATCGCGCAAGAGTACACGAAGTTGTTTCAGGAGACCAGACCC
GTGTTTGCGCTTGATGTTGCGAGCATGAAGAAAAGCGTTCATGTTCGTTTGGGCTGTATTCCCTGCTTGCATCACGCGGTCAGCATACTGGTCGTCGGAG
GGGTCAAAGGTAAACCCGTGAGGTAAGAACAGTTTCATAAAGGCCATAATCTGCTTTGACTGAGACTTGTACTGTCGATCATCACAGACCTCCCAGAGTC
GAGGCGTTTTCGTGTACCACTCAAACCAAGTTGCTGACGCAGTCTTTGAAGCCGAGCGAAACTTCCCTTTGGCA