Description :
From Genome Similarity Track
Location :
Scaffold_3:2340804- 2342708
Transcript NameFunction/comments
Phyin_T30-4PITG_02502T-complex protein 1 subunit zeta

Sequence
1904 bases(100 bases per row)
CTCCAGCCCAACCAACACATTGCCCACAAAGATCTAATAGTTACTGTACTTGCATCTTGAAACAGGCCCGCGCGGTACACTCAAGATGCTGGTCGGTGGC
GCTGGCCAGATCAAACTCACCAAGGACGGCAACGTTCTTCTGCATGAGATGCAGATCCAGCACCCGACGGCCGCGTTGATCGCTCGTGCGGCTACAGCGC
AGGACGACGTGACGGGCGACGGCACCACGTCCACCGTGCTGTTCATCGGCGAGCTGCTCAAGCAGGCCGAGCGCTTCCTGGCTGACGGATTGCACCCGCG
TATCCTGTCGGAGGGCTTCGAACTCGCTAAGGACGAGGCTCTGCGTGTGCTGGACGGCATCAAGGTCACACCCGAGGACATCCTTAAGGACCGTGAGCTG
CTCTGCAGCGTCGCCCGCACCTCACTGCGCACCAAGCTGGACCAGAAACTCGCTGACCAACTCACAGAGATCATCACGGACGCCGTGTTGACCATCGCCG
TGCCTGAACGCCCCATCGACCTCCACATGATCGAGATCATGCACGTACGTGGCTTTACTACTCTTGTATTTTATAGTAACAGTTGCTGATGCCTGTGTGT
TTTTTTATTAAAATCATACAGATGATGCACCAGAGCAGCAGTGACACTCGTCTCGTCAAGGGTCTGGTACTGGACCATGGCTCTCGTCACCCGGACATGC
CTACGTCGCTTGAGAACTGCTACATCATGACGTGCAACGTGTCGCTGGAGTACGAGAAGAGCGAAGTGAACTCTGGTTTCTTCTACAACAGTGCCGACCA
GCGCGAGAAGATGGTGGAAGCGGAGCGCAAGTTCACGGACGACAAGGTGCGTCAGATTATCGAACTTAAGCGTGAGGTGTGCACGGAGGAGAACAAGAAG
AGCTTCGTCATCATCAACCAGAAGGGCATCGACCCTCTGTCGCTGGACATGTTGGCCAAGGAAGGCATCCTGGCTCTACGTCGTGCTAAGCGTCGTAACA
TGGAGCGGATAACGCTTGCTTGCGGCGGAATGCCTATCAACTCGACCGACGACATGGACGAGTCTATGCTGGGATACGCTGGCAAGGTGTACGAGCAGAC
GCTTGGAGAAGAGCGCTACACGTTCGTGGAGGACGTACAGCACCCCAAGTCGTGTACGATCCTCATTAAGGGCCCGAACGAGCACACCATTGCGCAGATC
AAGGACGCTATCCGTGACGGTGTGCGTGCTGTTAACAACGCTGTTGAGGACAAGGGCGTCGTCCCCGGTGCTGCTGCGTTTGAGCTGACTGCGCACGAGG
CGCTAAACAAGTTCAAGGGCACAGTGAAGGGCCGTGCTAAGCTCGGCGTGCAAGCGTTCTCCGACGCTCTGTTGGTGATCCCTAAGGTGCTGGCGGAGAA
CTCTGGTCTTGACGTGCAGGACACGTTGATTGCAGTGCAGGAGGAGCACCAGAACTCCGGTATGCCCGTGGGTATCGACCTCTTCTCGGGCGAACCTATG
CTGCCCGAGCAGGAGGGAATCTGGGACAACTACCGAGTGAAGCGTCAGTTTATTCACCTCGCGACGACACTGGCGTCGCAACTGCTGCTTGTTGACGAGG
TTATGCGTGCTGGCAAGCAGATGGGCGGTGGCGGTATGCCCGAGCAGTAAATAGGTGGATACGTTGGTGGTTTATTCCCCCCCACTAGTTCATCCACTCA
CCACGCGCTGAGGCATAATAAACTGAGAAACACCCACATGATCTTTAGCTGCTTGTTGCTTTATTTTCGCCTGATATTTTTCAACGCACAAACAATAGAT
AAAATACCAGGATGTCGGTGATTGACAGCGCTACGATGACCATGTATAGACAGATTTTCTTGCGATACGAGCGGTCGGCGATGATCTGCAGTAGATGACG
CACT