Description :
From Genome Similarity Track
Location :
Scaffold_12:2340- 9789
Transcript NameFunction/comments
Pytve_DAOMBR484maker-pve_contig_12-fgenesh-gene-0.14-nitrophenylphosphatase
Pytve_DAOMBR484maker-pve_contig_12-snap-gene-0.52Protein H39E23.3, partially confirmed by transcript evidence
Pytve_DAOMBR484maker-pve_contig_12-fgenesh-gene-0.2Conserved gene of unknown function
Pytve_DAOMBR484maker-pve_contig_12-fgenesh-gene-0.16SET and MYND domain containing 1 isoform 1

Sequence
7449 bases(100 bases per row)
CCCAGCGCCTGACGCGCAGCGACTGGCAGCAGTGGATCGACGGGCTCGATGCCTTCCTCTTCGACTGCGATGGCGGTAGGACATGCAACATCTTCGCTCT
GCCTGCTGGGAAGATTCGATGGACCTAATGGGTGAATGCGCCGCGGACAGTTCTGTGGGTGGGCGAGACGCCGATCAAGGGAGCCAAGGAGCTCATCGCT
CTGCTGCGCTCGCTCGGCAAGCGCGTCGTCTTTGTGGTGTGTGGCTCTGCACTAGTGTGCAGTGGTATATTTTTGTCTCTAATTGTGGGGATCCAATGTG
GCGCAGACCAACAATGCCACCAAGACCCGCGATGCCTACGTCAAGAAGCTCGGTACGCATCGGTAACGCGTGGCTATCTGTGGATCTTTGGCTGACGCGG
CAGTGGCGGTGATGTGCAGCGTCTCATGGCATCGAGGCGGTTGAAGACGATATTGTCACGTGAGTTGCACCGATGAACAATGAAGTAATAGCTCCTTGTG
CTCATGTGCTCTATCCTCCCGTCCACTGCAGATCGGCGTGGGCCACGGTGCAGTACATGAAGCGCCAGAAGATCGAAGGCAAGGTGTACGTCGTCGGCGA
GCAGGGGCTGGTGACGGAGCTCGAGAACGAGGGCTACGAACCCTACGGACTCGAGCACAACGATATCAAGGGACTGCCCACGCCGCTGACTGTCGACCCG
TCGACGAAGGCAGTTGTTGTCGGGCTTGACCGGTGCGTACTGTTCTCGGATTCAAAATCGCTGTGCGCGCTAGACCACCACTAACAGGTTCAACGTTGGA
TGCGCAGGTATGTGTCGTACTACAAGCTCGCGTACGCGACGGTTTGTATTCGGCAGATCCCCGGCTGCCGCTTCATCGGCACCAACCCGTGCGTGCCTTA
TTTGAACATAAATGGTATCGCGTATGTTGTTGACGTGTTGCATCTCATGTTTCCACCACAGCGATCAGACGTTCCCGATCGACGGCGCCATCATCCCCGG
CGGCGGCTCCATGATCGGCCTGATCGAGTGCGCGACCAGCCAGTACGTTCACTAGATGCCGTCAGATTTCAACCTTCTGTGAGCGTGATTGACCAATGTG
GTGGTGGTGCTTTACAGCCCGCCAGAGGCGTACGTCGGGAAACCGTCTCAGGCCTTGCTCGACACGATTGTCTCGACGTTCAAGCTCGACCGTTCGCGCA
CGTGCATGGTACGATAGTGTTGCTAGCCTGCGTTCAATAGCGGCTTCGTCCCACTGACAACTGTGTTGTTTCCAGGTTGGCGATCGTCTGAACACGGACA
TGCAGTTCGGCAAACTCGGCGGACTCCAGACGCTGCTTGTGCTCTCGGGGGTGACCCACGTGGAGCAGCTGGCGAGCATCGACAAGCCCGAGCACGTGCC
TCATCACTTTGTCGACTCGGTCGACGTGCTCAACGAGCTGCACCTGCTCACGCAAAACTGATAGACGCCACCACCCACTGGAGCCTTTTGGGCTGCGAGT
GAGATTTGGAGTTCATAGATACACGATGTGTTGTATTCGCAAAACATTAGCGGCGAGCCACGCACAAAACTCGCTAGACAGTTGGCGACATATCGCCGCT
CGAGGTTGTCTTCAGACGAGGAATCGTCGAGTTCCCCGGGTTGACGAATGCGTCAAACATGGAAAAGCCGGTGCTCCCACCACCGCCGCCGTTCGACAGG
AGACCGCCAGGGATGCCGAACGTGTTGACCTTGGTCTTCTTCTTGGTCTTGGCCGTCTGCACGGCGTTCGCGCGACGGGAGGCATTATCAGCAGCAGCGG
CTCGTGTGAGATCCGCCAGGCTTTCACTTGGTGAGGCGCCGTGGCCGAAGGACGGGGCTGGCGATTCCATATGGACGTTATCGTTGGTGGCCGATGCTCC
TGGTGGATTTCCACGTGGTCGCTTCCGCATCGGAGACGCCATGTTGGGAGACTTGAGCGCCGAACGCAGCTGGAACGGCATCGGCGACTTCGACAGACCC
TTTGTGAATGCGAGGAACTGGAGCTTTTCAGGAGGTGGCGTCGCCTCTTTCGGGTGCTCCGTCATTTGCTGAGATCCACGCTCTCCTGCGATAGAACGTT
CGGACCGCGGAGCTTCAGCCCTGTTCGGTGTCTGCACATCTGCCGTGTTCTCGCGGGAAGATGAACCATTCTGGTTATTGGCTGACATGATCTTCTGGAA
CTCTGCACGCTTTGCAGCGAGCGAGTTGGTCGTTGATTTCTTCAGCGGCTTCTTCTTCTTGACTTTCGGGGTTGCCACGTCCTGCTGCATTTGCGAGATT
CGCGTGAGCATGTCCGCTTTGCGCAGCGCCTGCTCCATCTCGTTCAACTTGGCAGCTTTGCCTCGCTTGGGCTTTGGTCGCTTCGTCGTCTGGGGGTTCA
ACGACTTGGTCAAGTCGTCGGACGAGTCTTCGTCCGAGTCGCTCGGTTTAGCTTGGCGGGAAGCCGTCTTGGAATCGGCACCAGCCGCCTTCTTGCCAGT
TTTCAGTTCGCGACGTCCGTTGGCAGGCTTCGCTTTGCTGACTTTGCCTTCGGGTCCTCGTTTTCCTCGTACAGTCACGTTCGAGCTCACCTTGTTGCTC
GAGCCGCCATCGCTTGACCCACTCGAACCATCTCCCGCTTGGGCTGCGATACCTGAACGGCCCGCAATGCCGGTCTTCTTGGTCGCAACTCCTTTCATCG
GTTTGGTGACCGCCGACGCAGCAACTTCCGTCATCAAACTTCGAGCTCGAAGTGAGGCACCTCCATTCGCTAGAGCTGCATCACGGTCAGCAAGACGCGC
CAGCCGCTCCTTCTCGACATCTTTTCGGCGCTTGAGAGCCTTCTTCTGCGCCAAAGTAGTAGCCTCTGGCTCTGGCTCCACCTCGACCTCCCCACGCGCT
GCCTTCGCCTTGGTTGCCGCACGCTTCGCCCCCTTGCTGGTGAAATCAAACTCGACGTCGTTTCCGTTTGCTTGCATCCGCTTCCGCTTGTTTGGGGTCA
GTGCCTGACCTCGAGACTGCGTCTTCGTACTACCCTTCACAGGGCTCCGCGCAGATGTCGAAACAGGAAGTATCAGGCTCGCCATGGACGGCTCATCGTC
CAAGTCGGAGTCGTCGCTCGCCTTGTTCTGCGACAGCATGTTGAACAGTTCGTTGTCGTCCACGAGTTCCGGCAGCGGGCTGCTGCCGCCAAAGTCAGCC
GGGAAGTCGTCGAGCGACTCATCTTCCGGTATCCCTGATAGTGATGCTGTTGCTCCTCGACTCGATTTGGACTCTCCCTTGCCATCCGGAGTCTGCGTGC
TGATGCTGGCTGTGGCCCGCGCCGTCTTCTTCTTGATCTTACCGTTCTCTTTGCTCTCCTTGTCCGCGACCAGCTTCCCGCGTCCGCGCACAATCGCCTC
GGCGTGCTCCTCGGCATACTGCACCGCGAACTCGCGAGCCTTGGCGGTCTGCGCGCGCTCCTTGTCGCGCAGCAGCTGCGCCTGCTCGCGGAAGAACGCG
CGCTCCTCCTCCTCAGCGCGGTCGCGCAGCACGAGCTGCTGCCACGTGTTGCGTAGCTGCTTGCTGCGGATGTCGATAAGCTCCCACTGCCCCGCGACAA
CAAGCCACAACTCAGTCAGTCCATCCGTCTCCACCGATCGTTCTTGCCAGCTCCTGAGCCGTAGCGACAGTAAAACGCCACCACCGCCAGCTCGCTTGAA
TGATACACAGGCACACGCACCTCGAGCTTGTAGATCTCGAGCAGCGCCTCCTCCGGGTAGCGCTGCGGCGTCGCCATCGCCGCATCGACCGAGGTCCTGT
GCCTTGTTGGCGCCATTTTCGCCGTCGAGCCTGATTGGCTGATTTCGCATCGCGCATTTCGAATGTCAATATTACAAAACTGGGTGTGTGGGGGGTAAAA
CCTCAAAAGCAGGGGTTGAAGACACTCGCTCTTCTGTCGGCTCTTGTAGAGAGAGAATCCGGATTGTCACAATGAAAACAACAACGAGGTGAAGAAACAC
AATCAAGACGGGAAGTGCGACCGGGGGGAACTGCTACTTCGGGAACTACAATGAGCGGCGACGGCAGCTTCTGGCACCTGGCCGAGGGCGTGACGTGCCA
CGCGTGGAACAAGGACCGCACCAAGCTGGCGATCTCCCCCAACTCGAACGAGATCTGGATCTACTCGGGCTGTCAAAACGCCGATGCGTCCCAGTGGCGC
AAGGAGGCCGTGCTCACGGAGGTGGGCTTCCCGCCGAATTCTTCGGTCTGCGTATGGGGTTAACAGGTCTAACTGCGTGTGAAATGTGGCCAGCATGACA
TGGTGGTGACGGGGCTGGACTGGTCGCCCGTGCACGACATGCTCGTGTCGTGCTCGCACGACCGCGGCGCGTTCGTGTGGAGCTACGACGCGTCCTACCG
TCAGTGGAAGCCGTCGCTCGTCGTGCTGCGCATCACGCGCGCGGCCATCAACGTCAAGTGGAGTCCTGATGGTACGTCGCGGCGGTGCTGATTGCCCTGA
TTGTGAGGGGGAGACAGGCGGTAAATGATCATGTGTTCCGTGTCCAGGCAAGAAGTTCGCGGTTAGCAGCGGCGCCAAGTGTGTGTCGGTCTGTTACTAC
CAGGCGGCGGAAAACTGGTGGGTGAGCAAGATCATCAAGAAGCATAAGTCCACGTACGTACCTAGAGACCTTCACCCACATGAGGCGTGGTATCAGGTTG
TAATAACGAGTACGGATGCGTCGTGCTGCAGGGTGACGGACCTGGACTGGCACCCGAACAGCCAGCTGCTCGTGACGGGCAGCACGGACTTGAAGTGCCG
CGTCTTCTCGGCGTACGTGAGCGATGTGGACGGCTCGCCGGACGCCGGCCCGTTCCAATCGCTGGCCCCGTTCGGCGAACCGATGGCTGAGTTTGACAAC
GCCAGCGCGTGGGTCAACGCTGTCGCCTGGTCGCCAAAAGGCAACCGCCTTGCGTTTGCGGGTAAGACGTACTGTCTGATCAGTTGTCGATTGCAGCCGT
GTGGACTAATGTGATTGTGTGGCGCGCACAGGTCACGGGTCCTCTGTGCACATGGTCCATTTTGGCGCACCCGGCGAGTTCCCAACGATTCAGGTACGCT
TGGCCATCGGGTGTATCTCTAATCCAGTGAGCAGTGGCTGACTCGTGGGCTTCGACAGTCGATTCGCTTCTCGACACTGCCGCTCAACCGCATCATGTTC
TTGTCGAACGACTCGCTCGTCGGCGTCGGCTACGACTTCAACCCGCTCTTGTTTGCTGCGGACGGCAGTGGATTCTGGTACTATTTGAGTGTCCGATGCT
GTCAAGTGGATACTTATCGGGTACTCACTGTTGACTGTTGTGCATGCTCAGGTCGTTCGTTGAGTTTGTGGACAAGAAGCCGACTGAGAGTGCCGTGAAG
AGGAACTCTGGCGGCTTCAACGCTGGTTGGTTCCTTGGTTGGTTGCCTTTCTTCAGCCACAACGCTAGCCTAACGATCAATTATGCGTGTTTACAGCCCG
GAGTCTGTTTGAAAGCAAGGTGACGCGCGGACAGTCGTCCGACGCGACTCAGCACGATAAGGGACAGTTGTGGATGTGAGTCTGCGTCTCGTTGCTTGGT
AACATTATTGCTTGGTGGCTGAATGTGTACGATCTGTGCTGTCACTCAGGAAACACGAGAGCGCCATTACGGACATCCAAGCGTATACTCGCTCCGCCGC
CGGCTCGGTCTCGACATTCACGACGTCGGGTACGCTCTGCAGCCGATGTGGTGCATTGTGATGGAATCTAATTTGTGTGATTTGGTGTGCTGATGGACTG
ATCGCAGCTCTGGATGGCCGCGTTGTTCGCTGGGACCTTTCCAGCCTGGATGTGCAACTGGGCAAGCTGCATCTATAGACACGACGCTGTCAAGACGTGT
GGCAGAAGCGCGTCAAGTTCAACCCAAGCGATGGATCTAACAGCGCTCTGAACGCTGTCGTGTCCGAACGCTTCCACTTCCGCCTTCACCTTTTCCACGG
TGGACGGCTCGGGTAAATGCGGGTTGTCGCAAGAATCGACTTTCCCCGCGCAAAACTGTCAGTCTATTCGTACAGCTTCTTGATGCGACGATACTCCTGT
CGGTACTGGTTCTCAACGATCGAGGCTTGCCGAAAGTCCTTCCACTCTGGGAACTCCTCGAGCAGCGCCTTGGGATCGAGCGACAAGAGCAGCTGGATGC
CTTGGCTCACGTCGTTGAGCGTTCGGGCGAGGTCGATGTGGTCCGGACTCAGGTACGAGCGCTGCAGCTCGAGCAGCTCGTAGCTGCTGCGCAGGAAGAG
GATGGCGTACTCGCGCACGTCCTGGCGCGGCTTGCTCTTGAGCAGCAGGTCGCAGCAGTCGGCCACGAGCTTGTGGATCCGCATGAACACAAGGTGGTCG
TGAGCCGCCATCTCGAGCGCGTCCGACAGCGCCTCGAGGGCGATCGCCAGCACGTGGCCGGCGCTCGACTGGCTCTCCTTGAGCATGGCTTCACTGGCGG
CGAGGATCTTCTCGAGCTCGAAGATGGTCATGTCCTCTGCGCGCGGTTGAGCAGACGAAGGAGGCGGCGGCAGCACGCTGTCACCGCGTCTGCACAGCGG
ACAGACGCAGTCGAACCCGAACTGGTCGCGCAGGTTCTGCTGGCGGCGCTCGTAGCTTTGCTCGCGCGGATACAGGTACGAGATCGTGAGCGGCTCGCCC
TTGGCGACCCTCTTGGCCACGCGCACCTCGGAGATGCCGTCGCCCTCGGTCTCCTCCGGCGTGAACTTGACGCAGTTGGGGTTGCAGTCGTGGTTGAAGA
TGGCATTGTAGAGGAACACGCCGCTGTCGAAGGCGTTGCACTGCATGGCGAACACGTTCTGCAGCAGCGCGTCGTGGCTGAGCGCGAGGTCGCGGAAGTT
GCGGCGGAGCTCCTCGATCTGGCGGTCGTACTTGGCGCGACCGGCCTCCAGCAGCGCCGCCGGCAGGTCGCTCAGCTGCCGCGGGAACAGGAAGCTCAGG
TGGTCCATGATGTCCTGGTAGTCGTCGCGCGCGAGCACCGACTCGAGCGTCGCGACGAAGAACTCGGGGTCCGCCGGCTCGACATCGTTCGGCCACGGGA
TGTACATCTGCTCGACGAGGATGCGCGTGCCCGGCTCGAGGTCCCGCGCGGCCACGTACCCGCGGCTGCCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNGAGCTCGATGGGCCCCACAGCCAGCGGCTTGACGTCGTCCCACGGCGCGTACAGGCTCGGCACAAATGCGTCGAGAGCGGCGGAGAGCTGCT
CGTCCGCGGCGGAACTCGCCGGTGCCGCGTCCGGAACGATGTGGATCGCCTCAAGCTGCTGCGAGGCGACCGCGACCTGCTCGTCGTCGCTGCTGTCGTC
GTCGAAGAGCCCGAAGGCCGCCTGCACGGACGCGCTCGGCACTGCCGAC