Description :
From Genome Similarity Track
Location :
Scaffold_2341:234- 3707
Transcript NameFunction/comments
Phyta_totarag14391reverse transcriptase
Phyta_totarag14392hypothetical protein

Sequence
3473 bases(100 bases per row)
CTCAAGAGTAATATTCCNCCGGCTCCGCATGttcctcgtccacgcccGCTTGACCGGGCACTGGACGGGTTCGCGTGTTGTCACCGGCGGATTCTATCCG
CAGGCGCGCACCATCAAGCCTGGCTTGATGtgccgcttcttcgtgcagccagGCTGCACGAGAGCTGGCAAGCTTGTCTTGTGCTGGACGTTTGCAACCG
TCCGCACTGCTCGCAGCATCAGCTCCCGGAGCTGANCAATCTGAGTTTATCAGATTCTCAGTGTCGCTTCCCAGAACCGACACACATTCACAGATCtaga
tgaagaagcgactGTGTATTTCCACGAAGGTCAGGAACTTCTGAGCAATCTCCGATATCAACTAGCAGCACTACCTGAGCTGAGAGATCTCAGCCCTGAG
GCGGACCTCGCAAaggctgaagttggcgaacCTGAAGTCACTACCCCTGAGATGAATGCCCAAGTACATGAAATTCTGGAACGGCATCATTCCAGTTTTC
TTGGTGATGGTAATGTGGTCCCAGCCCCAGTCAGAGGTGTCGTTTGTGATTTGGATGTCGGAGATGCTAAACCTGTCGCTCAACGATCTAGACAAGTTCc
tccacatcaacttcagAAAGTGTACGATCTGCTCAAGAAACTGTTGGAAACTGGACTCGTGGAATACTCGAACTCAGATTGGGCATCACCGATCGTCAtt
gtgatgaagaagaacggtgTTGACATCCGACTCTGTATCGATTACCGACTAGTGAATCAGCTGATCAAGCTCATGCACTATCCTCTACCTTTGATTGACG
ATTTGTTGATTGGGTTTGAGAGTGCAATGTGGTTCCTGAATTTGGATATGGCTAGTGGCTTTTGGGCAGTGCCGATGACGCTCCGAGCGAAACACATCTC
AGCTTTCATTTGTCCGCTCGGTCATCTCAGTGGACGCGTATGCCGTTTGGTTTGAAGAACGCACCCCTGATCTATCAGCAGATGCTCGATAACTGTCTCT
GGGGATTTGTGCGACTTTCGCCCAACGAGGAAGCTCAGATGGACGCTGAAGTGCTGGAGTTCTTAGGAATTGTGGCAGATACCTCAGTTGACGGTGGTAA
AATGGCGGTGCTGTCTGAGGAGCTAACTGTGTTCCGAAGGAATATCCTAGCCCCACCTCAGCTGAATCCGATTCTGGGAAGAAGTTCCTACATCGATGAT
ATCGCGTATGGAGCTGAGACCTGGGAACAGATGTGCATTGACCTGAACCGTTTGCTGTATCGACTACGCTACTGGGGCATCACGGTGAGCTTGCCCAAGA
GCGAGTTTGGCAAGAAGACAATTTCGTATTTGTCTCATGAGATTGGAGCGGAAGGGATCCGAGCCAAGCCGACGATCGCCAAAGGTGTACGGAACCTGCC
GTTTCCGTCAACTCTGAAAGGTGTGCAGTCATTCCTGGGAAGTTTGAACTATTACAACAAGTTCATTGAAGATCTTCCGGTCGTGGCTTCAGTGCTGTAT
GAGTTGACCGACGAACAGATTCGTGCTGGTCGAGACCTCAGCCGTGCCAAAGAAGCCTTTGATAtcctgaagcagaagatcatcTCTACCCCGTTGCTCA
GACACCCAGACAAGGAGAAGCCATTCGTGATTATCATTCACGCTAATCCTTGGGCAGTCAGTGCAGTGCTGGGCCAGGAGTATGACAACGTGATCCTCCC
AGTGCGGTACACTGGAAGAGTACTTCATGATCAGGAACTCAGGTATCACCCGGCTGAGAAGGAAGTGGTGGCTTTGCTCAGGGTTCTCAGAATATTCTAC
ACGATGTTGGCCGATAGCaaactgctgaaggtgtATACGCGTTACTCAGTGCTGAAGTGGATCTTCAGATCTCAGTCTCTGGAAGGACGCTGCGAGCAGT
GGGCTGCAAGACTAACGCCGTGGCCGCTGGAGATTCACATGGTCAAGTCGGACGAGGATGGGTTAGCCGCGATTCTGGGAGCTGGGATCACTCCAAGAGA
CCGGCTCGACAAGGTTACAGAGAACCTCATCCCATCCAAAGGGCGTGTTGCCCAAGCCTCACCGATTAGTCTGGAGATGATTGAAGCGGATTATGAAGGG
TGGCTGCTCAGTTTCGATGGAGCCGCCAAACTCTCAGATCGACGGGGCAGTTCCGGGTGTGTCTTGTGGAAACTTCCGTCCTGGGACGTGATAGAAGCTC
GAGGGTTTCACTTTGAGGGTATCACAGTGAATGAGACTGAGTATCATGGTCTAGTCGAAGGATGCCGTATGGCGCTCGCTCGCGGGATCTCAGAACTGGT
CGTAGTGGGAGATTCTCGGATTACTATCCAGCAAGCCCAGGGTTTGATTCAATGTCCGAAGCCGGGGTTGCAGTTGCTACTCACCGAGTTCCAAATGATC
CAGCCGAAGTTCCGATCGCTGAAACTTGTGCACGTGAAGCGCAAGTACAATGCCACAGCGGACTACCTTAAGACTAAGACGTTGATGGCCAGAGGCCCAG
TTGTCATTGATGACCCGGTTGAATTGActcagctgaagcagctggatcGGATTCCtgagaagttgatgaagatggctgaGCCAGAACTCAAGGCACCCGA
GACAGATCAGTCTGAAGAAAGTGAAGCCAGGGACGTTGTAGCAGAACCAATGGCCCCGGCTGCTAAGATCTTTGTAGTGACCCGGAACCAAGCTGGAACC
AGAGTCACTGATGAAGGAACCGAGGAAGGCATCTCATTTCCGAACTGAATACCCCCGCAGCCGAAACTTACGTGCCAGAGGAAGCGACGCGCGTTGCGTC
AATTTCTGAACGATGGCGCAGGATCCTAGCTCAGCAGGAAGCTGAGTCCTGGTCTCAGAAGCTCAGAACCTACCTGAAGGGCGATCTGGGAGAATTGTCG
CCAGCCGAAGCTGAGGAATTGGCCAAGGTGGTGGACCAGTTTACTCTGAATTCCCGAGGTGTGCTGTATTATCTGAGTCGACCTACTCCGAGTCGCCCCA
GGGATGCAGCTGGGAGTCTGAGATTAGTGGTTCCCAGTTCTCTCAGACaaaacttgctgcagctcagccacgaAGACTTTCAGGGTGGTCATCAAGGGAT
CACGCGAACTTTCGAAAGATTACGCCAAGAGTACTACTGGCCTGGAATGTATGCAGACGTGGAGCGTTACGTCAAAGAATGCGTGGATTGCGTCACGGCC
AAGGGAGCGTCACCGAACCCCGGACCTTCACCTGGAAATATCCTAGCGACACGTCCATTTGAAGTGGTCTCCATGGATTTCGTTACGCATCTACCCAAGA
CCACGTTTTTCTGCTGCTATTTCAGTGTTCGTTTTCTGGTTTCGTCATCTCCAAGCCtatgagcaccacgacggctcaggaagttgctgaagcataCATG
GAGTGTGTATTCCAGAGGTTTGGAGCAAGTGTTATGCTTCGTCACGACAGAGATCCGAGATTCAAGAGCGAAG