Description :
From Genome Similarity Track
Location :
Scaffold_113:234- 2868
Transcript NameFunction/comments
Phypl_g3405hypothetical protein PHYSODRAFT_462863

Sequence
2634 bases(100 bases per row)
CCTCTAGGACATCTTCGTCAATGATGGACGAAGGGTTCAACTCTTCCGGAGTTGGCTCAGGTCGTATGAGGACCAactcgtcgatctcgccgGCCTTCAA
TTCGGCCAGGAAGTCTTCCAGCAAGACTTCCTCGAGATTCAGAAGCTCTGACACCTTGGGCAGCGGTTCCATGTGGACACCGCTCACCTTGACACGGCGT
CCCGTCCCGCCATCGAAGTCGTGGTAGTTCTCGGAGGACGTCCGTGTCCGTGGAACTTGAGCGTTTTGCTTTAGGTCAGCCTCATTGATCTTGTGGTGGC
ATTCCACCAAGCCCCGAGCAGTGGTTGCTTGCGCGACCTAACGTAGGACTGTGTTGCCCACGCTCAGGGGGGTCCAAGTCCCGGAGTTGACGCCTCCATG
CGGTACTCTGTTACCCGCGTGTTCGTGTGAAACTATGTTACCCACACCGGAGGTGGCCTTGACAACCTCCTCGGCAGCCCGAGCCGTCGATACTGCATGT
GGTACTATGTTACCCGCTGGTGGACCTAAGTTACCCACTTGGAATGTGTCCGCCGACAATTCCACAGTCGCGGCACCGGGGGTACGGCAACTCTGAACAC
CGAGATGAGCTAACGCAGCGGTCTCGTGCTCCAGTTCACACAAGGCCTCAGCCTTGTGGACGCGCGTATCCAGCGTGGGGCAGATATCCCTGTCCAGTGA
CCTAGCCTTTGGCGGCCCACGAGCTCTGCTTGCAGTGGACGAGATCTCACGACCTGTTGCGGTGTCTCGCACAACGGCTTCTCGGGGAGCGCCTGTCACT
GTGACGATTCCCATGTCTTCTTCGGGCGTCCGTACGCCCCGGACACCGTCATGTCGCCTGGCAGAGGTGGGAACTTGACTCACCTAAGCTCTGTCGGAGA
CGGGAGACTTACTAGCCCCTATGGGTTTTCCTCGCCAGTCAATCCTCGGCTCATGCTTTTCAACCCACGGCATGCCGAGGATCAAGTCGTACTTGTCCAT
GTCGAGGACAATAAACGGCTCCGAGCTGTAAAAGTCTTCGAATTTGACCGGCAGCTCCATGCAGATCTTGAGCACCTTTACGATGATGCCTCCCCGAGAC
CAGCCCGTTCCCCGCGCTCTCACGTAGTGCGTCGGAAAACTTGTCGCTGTTCCTCGCGACACTTCGACGTCTAGCAATGTTTCTAGCCGCCCCAGCGTCA
ATTAAGACTTTCAGGGGGTCTCCGTATCCCAGTACACGCGCGTGTACCACTAGCAGCCATCCGCTGCCCTTCTCTGATTCGAGAGAGCATAGTCTCTCAG
GGGCTAAGTCTCCACGGTGTGCGCCACCCGCACACCCGTCGTGAAGACTCACAGCTTCCCCAGTAGGGCGCCCCACCCCTACTGATGTCCTGGGTTCCAT
GTCCCCTCGGGCGCGGCTTCTGCCAGCGACCGTTCGGTCCTTGGGGGTATGCGGAAGGAACTCCTTCCTTGTCCTTGCGCAGGACAGGCTCTTTGCATGT
GCCCTAGGTTACCACATCCGTAGCATCGGATGTCGCGCTCATCGGTCGTGCCCAAATCATTGGCACCGGGCCCGAGCTAGCAACTGGTAAACTCATACCT
CGTATACGAGTCTTTCGATGGCTGTACTCCTCTTGGAGAGAGGGCTGAATAGCCCCCTCCATCGTCGAGGCATGCACACAGAACCGCTGTGTGCGTGCCG
GGCATACCCGAAGGCCTTCCATGAAGACCGTGACCTTGATGCCTTCAGGTCGTGGGTTCCCTACCAGAGATGCTGCCAAAACAAGCATCTCCTGCACATA
CTCGAGCAGGTCACGCCTCCCTTGATTGCAAGCAAGTAAGCGTGACGGCTGGTGATACTCGATATTCGACGGCAGGGAGGCGACACGTAGTTGCTCGACC
AACTGCGTCCAGGACGTAAAACGTCCAGGGGATGGTGTAGGCCCAACTTTTAGTTATATCGCCAAGCTTCGAAATCACGAATGCGACACGAAGTCGATCG
TCCGAGATGAGGCCCGCGCTCATCGCGATCTCTACTTCTCGGACCCAGAAATGCAGGTTCTCCCTTTCCTTGCCTTCGCAGGCAACAACCGTCAGCCGCA
GAGGCTTCAGCCCAGGGGGCTTGGATTGAGCCGCGGGTGTTTGTAGGCTACCCTGAATGTGGGCAATCTGTTCACGTTCATATGCGTCGAACGCGTTCAC
GCGAGCGACCTGCTCGgctggcgtcgccgccaccaaaCTCCGCAGGGCTTCCAACGCAAAGATGCCTCCCACTGGGAGTCGTTCAAGTGAGGAATCTCAC
TGCGTTCCATTGTGGCTCGCTTCTCAAGTCCACAGAGGATTCGGGTCATCAATCTACCCGCGTATGTGTGGATTGACTACAACTGCTACCAAGTGTGACA
GGGTCACACAGCACCTTGCGAGTGGAAGTGTGCTTCGGGGgtatacaaactcccagtgaacggCAGTTCACAAGTCCCTGGTCTGAAGGGGACTAAGTAC
CAAATAggtaaaagtaagactgaatatatttatagggctgtagtttggcctgcaatacaaactactAGCtacctataatgaaacctagAGAGCCATTGAT
TCGTTGGCTCTGAGAGCAACTGGTACTGTGTACC