Description :
From Genome Similarity Track
Location :
Scaffold_90:234- 12809
Transcript NameFunction/comments
Pytiw_DAOMBR242034maker-piw_contig_90-snap-gene-0.10Novel protein
Pytiw_DAOMBR242034maker-piw_contig_90-fgenesh-gene-0.2Conserved gene of unknown function
Pytiw_DAOMBR242034maker-piw_contig_90-snap-gene-0.14NEFA-interacting nuclear protein NIP30
Pytiw_DAOMBR242034maker-piw_contig_90-snap-gene-0.12Nucleolar preribosomal-associated protein 1

Sequence
12575 bases(100 bases per row)
AAGACCAACTGCATGATCAACAAGAAGCCGGCCACCGCGGCCACGGCCTCCAAGAGCGCGGCTACTGCTCCTGCGACGGCCACCAAGAGCAACGAGGATA
TGAAGCAGTCGTACAGCGAGTACAAGGAGCTGAGCGACTCGGAGGAGACCGAGGAGACGGGCAACGAGTACGACGCCGACGAGCATGAGGAGGATGAGGA
GACGACGTACAGCGAGTAAGTCAACTGGCTGCTTCCAGTCTAGAGGCCTGCGTCGTCTTTGTAAACTGCCGCCGACGGGAGTCGAAGAGCGACGGCGACT
GTGGACCTATTTAACTGTCTCGGCCCGCCTTCACCGTTCGCCCACCGCAAGACCGTCCGTCCATCTCTCAAGAAGCTTGCTCGCGGTGGTGGGAGTCCGT
TCTTTTTGCTGCATGTCAACTTGTCTTTCTTTGCGTCCCGAGTCCTACCGAAAAGCTCAATACAACAAACGTCCCCACTGGGTTGTCAATATACTCACTG
TAGCTGTGTGCTTGATGGTTGGTCCAAGGCACGCTCGACTGGTGATGTCCATCACTGGTGGATCTATTCACCGAAAAATGTAGCCATAATCGAACAGCTA
CCCCACATTTGTGACATGTGGCTGAAGCGAGTTGATAGTGACAGGGACGCGTCCTTTCGCGCACGCGCTCGCTTCAATCACCACCACGCGTGACAAGTTC
TGGTCTCTGAGAGCGAGAAGGAGGGATGCCGATCGACGTGACGGCACGCCACGCGTTCGCGTACAGTGGGCGGCCGCTGCAGCTCGCGGACGAGCACACG
ATGGCGTTCGTGAGCGGCAACGCGCTCGCGTTCACATCCACGGTCTCCCACTCGCAGCACTTCCTGCTGCGCTCCAAGCCGCGATCTCTCGTGGCCTTTG
ACTGCAACTGGCGCACGGCGACCGTGGCCATGACGGCGCGCGAGCCGAGTCCCGACATCCTGCTCTACTCGTATCCGGACAAGAAGCTGCGTGGCAAGCT
GCAGCACGGCGCGCGCTTCGAGTACTCCAAGCTCACCTTCTCGCGCTGCGGCCGGCGACTCGTGAGTCTGCGGCCCTTGGATGCGGACGAGTCGGACGAG
AGCTCCTCTGTTGCTCCTGCTGGCATGAACAGTGGACCCACGAAGCCCCGGCTCGTAGCCGCAGCCAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNAGCGACTCTGCGTGTGGGACGTCGAGCAACTCGAGCCCGTGAAAGGTTGCGCGGGTAGCGTGGTGACCATCGACGCGGCCTTCGTGGC
CTTTGACCCAGCGAACGCCGACCAGTTCGTCGTTGGCGGCGACGACGGCATGCAGATCTGGAAGATCTATCGCGGCAAAGGCTCGAGTCTCTTGCGCCAC
GTGAGCGTCCACTTGGGCAGCAGTGCGGCCGCAGCGTCTACGTTCGGCCGCGTGGGCGTGCAATCGAGTGACGACGACGACGTCAGCGAGGCTGAGCTCT
TGGATCTCGAGGAGAAACGCAGCCAGTGGCTCTGCCACGCCTGGCTCAAGAATGAGAAGCTCCTGGCGGCCAACCGAGCCGGCGAGCTCGTACTGGTGGA
TGCGGCGACCGCGACGATCGTGCAGATCATCGAGGTGGCTGTGCAGCCGAGTCGTCGCTGCATCGCGGCGGTCGTGTACACGGTCGATTCCGTGGTCGTC
GCCTACGCGGACGGCCACGTGCTGTGGCTCAACGAGAAGACCTGGGAGGTCATGCAAAGCGCTTCTCTGCCAGTAGTTAGCTTGGAGGCTACTCGTGGAA
TCCAGCATGGCTCTGCTTCTGCACTTGAGACTCCAGGTTCGTCGGCTACCGAAGTGAGCCTCGTGGCCTGCATGGCGCCGTCGCCCAACCACTCCAAGCT
CTACATTGGCACACGGGACGGTCGCATCTTTGAGCTCAAGAGCAGCGTACTTGTGGACGAAGAGGAGGACGACGAGGGCGGTGGGGTCATGGCCACCAGT
CCTGGTCATACCACCAGCAGCAGCAACAACAACGACTCGCACCTGGTCGTGCCCTGCGGGAGTTTTCCTGTGGGCGCGGTGCTCGCGAGCTCAGCGCTCA
CGCCCTCCGGTGGGACCTTCCTCACGGACGCTGTGGTCGCGAGCGGTGGCGTCAGCGGATGCCTATACCTCTGGAGCATCAGCAAGTGTCGTCTCGTGGT
GGACGTTAGTGTTTCTTTGCTGTTCGCACACCCACCAACGTCCCACTCAGCGTCCTCCGAGGGGTCCTTCAGCGGAGGACAACCTGGTGGACCGAGTCAG
TCGAGAGGCTCACTGAATCAGATCTCGGGCTCCGAATCCGACGAGAGCCTGGCAACCGCACCCGGGAGCCATCTGAGCGCCGAGGCCGCGCCCTTGGTCA
TCATTACGGCCCTGGCGTCCAAACCGGCGGATCCCGTGCTCCTGATCGGGGACCAGACTGGCCGGCTGCGCGCGCTGTGTGCGTCCAAGGTCGGCGGCGG
TAGCGGGGCCGTCGAGCTCCTGCCTCTTCACTCGCTGCAGCTTGTGGCCGACGCGCCGCTCGACATCCTCGAGATGCACCCGACGCAGGCCGTGGTGCTG
GCCGCGTCCACACGAGCCAACACGGTGTTCATCCTGTCCACGGACCACGAGAGGCACTTCGCCGTACTCGCGTTCTTCCCACTGCTCGAACCCAAGGAGC
ACGTCGTGGACGTTCAGTGGAGCCTGCCAGCGCACAACAAGAGCGCGCTCATCGCCACGTGCTTCTCGTCCAACGGACTCTTCTATGTGGCTCGGTACCA
GCAGAGCGACACTATTGACGCGAGTGACCCCATGACGCCGCCTCTAGAACTGCGAGCCAAGGTCGTGGCCTTTGGTGAGGACATGCTGCCCAAGTGCTCG
AGTCTGCGGTTCTTGGGCAACGCGCCCATGAGTATGATGCTCGCGACGGCCCCCGGTGGCAACAGCGTCCACGTGATGAAGTACATGGAGATAGTGTTCG
ACCCGACCGAGAAGATCAGCATCCTGGCCAAGGTGCTGGCCCAGGACGCCCATGAGAACGGGATCGCGACCATGGCGCTCTATCCGCACGTGTTGGCGGA
CGGTGCCGAGCTCGTGGCCACGGCCGGCATGAACGGGGCCATCACGATCTGGCTCGTGGCATTTGGGGCCGGCGACGCCACTGATGGTGAGGCCCCACCT
TCCGAGATTTCTACACTATCGGCTGGTAAAGAATGGCAACTCGAGGACGTCCAGGCGGCCAAGAAGAAGACGATCGTGGTCCACACGGGGCCCGTGACGT
CGCTCCTCTTCCTCAACGTCCAAGACGACGTCTACCTTGTCTCGACGGGCAGCGACGGCTGCGTCTTCCTGCTGGATGTACGCATCCCGATCGAGTCCAA
GGCCTCGGTCTCAGATTCAGACCACGAGCTCAACATTAATCCGCTATACCTGAACGTGACGACGTTCGCCAAGTACGGCGAAGCGTTCAAGCCGACCCAG
GAGCTCGAGCAGAAGCCGTTCCTGCAGGTGCTCCAGGAGAACGACGCCTTTGCGGCGCGCAACCGGTTCGATCGACTCAAGGACCAGACGCGCGCGCAGC
TCAACGACCTCGAGCTCAAGCTCAAGCTGTTGCTCGCCGAGAACGACAAACTGCCCGAGACGGAGCGGCTTGCGCGCGACGAGTTCGTTGTGAACGTCGA
CTGGCGCGACCAGCTGCTGCGCAGGAACAGGGAGCGCGCTGAGCGCGTACGCGAGGGGATCCTCAAGGACCTCGCCAAGATGAAAATTGTGCGCGAGCGC
ATGAAGCACGAGTTCTGGGACTCGGCCACAGTCCAGGGTGTGCGGCTGCGTGGGCTTTCACCGTCTGTGCCTGGGCTTGGGTCTCAGCAGAGCAACGGGC
TCTTTGTGTACAACTTCCCCATGCGCCGGCAGACCAAGCAGGAGCTGCTTACGGCCAGGAAGATTGAGCTCATGCGCACGATCGAGTTTGCTCACCAGCA
ACAAGAGGCAATCGACAATGCGGGTACTTCCCAAGGCTCACAGACGGACACGGCGCTCTCGCGGTTCAACCAGGTGCTGGCGCCGAGCAGCAGCAACCTT
CAGTGGCTCATTGACGCGGGGCTGCACCACCCGTCGCTCAATAAGTGGCTCGTGGACAAGGTCAAGAGCTCTCCACCAGCGACAGGAAGCTACGCGGAGC
TGCTGCCGCACCAGCTCGTGTACCACCCGGCGGCGATCCGCACGCGCAAGCAGCAGCGCATGCAGGTCCACGTGCTCAAGGTCTTTGTGCGCGCACTCGT
GGTCGAGTTCAACGACGAGTTCAGCGCGCTCATGCGCCTGAAAGAGGCCAAGATCGAGGAGATTGAGGCCAAGAACTCGCGCATCCTTGAGATCGGCGCC
GAGCTTGGCGTGTCGCCGGCCGCCCAGGAGCTCTACCGACCGCAGTTGGCCCCGGACGAGATCGCGGCGTCCATCCTGGAGGTCAAGCCCGCCGAGATGA
CGCAGAAGATGTATGAGACCGAGGAGATGCGCCGCAAGCGCGAGAAGGAGGCCCAGGAGAAGCTCGAGCTCGAACGGCAGCGCCAGAAGGACGACGCGTC
CGGCCGCGCGCTCACAGACATGATGGACGGCACGCTCGAGGTCAAGAAGGAGAATCTCGCGACGCAGTCGTTCGTCAAGGAACAGTGGATGCTCGATACA
TCGGCCGACGAAATGACGGCCGAGCAGAAGAAGCTCGTGGCTCAGTTCGAGCTCGCGCAGCAGAAGTTCCTGGAGGAGAAGGAGAAATACAAGAAGAGTT
TGGACCTGGAGCTCAAGAAGATCCGCGGTGAGATCAGCGACGTGTGCAAGGCCTTTGACGAGAAGCTCCGCGGACTCCAGGAAAGCTACTTGCACATGCG
CAGGAGCGTGCTCGTGCAGCATCTGTACGAGCTCCGGCTCGCTGAGGACCTCATGGACCATGAGCAGCTGCTGCTGGGACGGCAGCGCATTGAAGGCGCG
ATCTTGGAGCTCCAGGCCAAGATTCGAAAGAGCGAGCGCGAGAATGAGCTCTTCGCAGCTCAGCTGGACGGCTCCAAGGACGAGTGGCACCGCACTGTGG
ATGAAGACAAGAGCTGCGAGAAGAATTTTCTCCGAGATCTCGAGGAGCTTACGGGGGGCAGCACTAGCGGAGCCGGAGCTGCCGGAATTGGACCAGCACC
AATGGAGCACGACTTCATCAAGCACCTCGTGGAGCTCTACAAGAAACGGAAGGGCGACGACTTGATGCGTGACGGCGGAGACGCCGTGGCGAGGAAGGGC
GGTACAGCCAAACGCGGGAAGAGCTCGCAGCACCTGGGCATGGGTGCCAGCAGCCTGCAGCTCAACGCTGGGACCTCTGCGAAGGCGCGACTACTCGCTG
AGGGCCTGAACTCCGACCCGTCCTCGCGCAGTCTCTCGCCAGTGACGCTGCTGCAAAGCCTGCAGCATTCCAACAGCGATGGCGTGGAGGGCGATGCGAA
CGTGGACCCATTCCAGTACTTGGACTACCAGCAGCAGCCGCAGCTCAAGCGGCTCGACTCGGGCAGCGTCAGCGGNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNACGTCGTCCCACTTGACTACGACGTCGACCGGC
CCGACAGCGTCCTCATTGAAGACCGCGTGTGGCGCGCACTTAACGCGCTGCGAACCAAGAAGATCCTGGCGGAGCACAGCGCCAAGGAGAAGGCGGAGCA
ATACGCGCTCGCCAAGAGCGTGGCCGAGGAGCTCCGCGCCAATATCACGGAGCTCCAGTATGCGCTCCAGGAGCAGGTCTCTGGCTACGAAGCAACGACG
CGGCAGCTCGAGGCGCTTGCGGACAACTCGCCACTGCTCGTGCACATCAAGCAGGGCCAGGACGAGTCGAGCACCAGCGGCGGCAGCGTCGACGCGGAGG
ACCTTCTTCGGTACGCGGCTCCGGCGGACGCGCTCCTGGTCGCGCGCGCCAGCGTCGAGTCGCTCAACGACGTGATCCAGCTCCACGGAAAGGACCAGGT
GGGCATCCTGGGCAAGATCAAGAACTTCCGCAAGAACATCAATGTGATGGAGTGGGAGCACACTCTGCTACAGATGCAGACGCGCGACATGGAGGAGCGC
TACACGGACATCCAGCTCCTGCGTGTGACCAAGGACCTCCAGGAGCTCTTCCACACGGGCGACACGTCCGAGAAGCAGAAACGCGAGGTCGCGCTGCTCC
AGGCCAAGATGGTCCACCTCGGTAAGAACCACCAAACGAACTTACTTAAGCTCGACCAGGTCATGGCCAAGCTCCACAAACAGTGGCGCGAGCGCGTGCG
CGAGAACCAGGGCTTCGAGCAGCAAGCCCAGCAGCTCCAGATGCAGGTGCAGATCCGCGAAGACATCCTCTCGAGCCGCAAGAGCGCCGCGCTGCGCAAC
GCCTCGGCCGGATCCTCGTCTTCATACGAGGCCGCGGAGAACCCGCAGCTCAAGGCGATCACTGTGCGGCGCAAGCTCGTGGACTTGGCCAGGTCACAGA
CCGAGGAGATCGAATTTCTGCGCATGGAGCTGGACAAGATGCGCCGGCGCACGTTCCCGAGCTTCGTGCAGCACCAGGCGGCACGCGAATACCACGCGAG
CGACAGCAAGTAGGCCAGCAACAAGCCTATATCAATCAGTGTAGGTATATAGACCAACATGCACCATTCAATCAAATTCAGTGAGAGGTGAATATGATAA
GCGAGCTTGAATGTATTTCGTGGAGAGGGTAAGCTAGCGTTCAGGGTAGCCATGGCGAGTGTCCACCGCACGCTGCTATCGCACCAAGTACAACTACGAC
GACTTGTGCTTTAGCTATGTCTTGCTTGCTCCAAGTAGCCTTGGCAGCGAAGTTAGAAGCGACCAAGATGCCCCAAAGTACGAGATGCCGGCAGCGAAGA
GCCCTTCGTCCTCTGTCTCTCCTAGATCCAACAGCACAGGTGCATTGGTTAGCAATCACACGCACATCAACCAAAAGTCACGCGACTCACCCCGGTAGCG
CAAGACAGCTTCCGGATCGTTCCGCACCTCCACCAAGAAGTGCAAGTCTCCACTCCTCCGATCGTCAAAGTCTTTGCCAAGAATGCGCGCTTCATCTAGA
GGCAGTATGTTCGACAGCTCCCTCTCTGGTCGCATTAGGTGCTTGGTCGCATTAGACGCTCGTCGCTTCGTGAGGGCCTTGACGTCCTCATCCTCGATGT
TGAGCCACGCGCCGCTGTCGGCGCGCTTCGCAAGGTAGAGCCACAGGTGGTACGCATCGTCAGCATCCAATTGGGGCACTTCTCCTTGAGCTTCCTCTTG
AGCTCGTAGACTGGCGCGCTCAGGTCGCCCCTCGCAGAGACCACGAGTCCGCGCTTGACGATGGCGCAGTTCGCTGAGCGCGCTGCCATTGTTCTCAACA
GTGCAAACTGCTCTTTAAGATGGAATCGCCATCCATCGTTCCTTCATTTTCAAAGTGTCCATCTGAGATGGACGAATTCTCTTACAACCGGCTCGGCTTG
GCTCGACACTCCATCGCTATTTTTGTGCACAGCGGCTTGTTGCGGCTCGTTTTCGTTTTTGGCGACGAACAAAGAAAACAAATTGCGCCGACAAGCATGG
ACGCGTGGACGCAGCAGTACGCGCAGGCCGTTGCAGCCGCAGACGCCGATGGCGACGCCAAAATGGCCTCTGCCGCCAGCAGCAGCAGCACGGGTAGCGT
CGTGCGGTTCTTGGAGAACGTGTTGACGTCAACGAGCCCGACCGCCAAGTCGTCGTCAGCACCGCAGACGCAGCCTGCACTAGCCGACATTGGCAAAGAG
CTGCTCGTGCCTGTGGCGGAGCTGAGCACCATGAAATTGCAGAAAGATCAGGGACTGGACCGTGATGCTGTGATGCGGGTGCTGCAGCTGCAGGTGATCT
GCCGCCTGCTCTGCTGTTGTGACAAGAAGAAGAAGGACAAGACAGTCACGAGCAGTTCAAGCACGACGCAGCTCAAGGTGATGAAGAAGGAGATGCGCAG
TCTCTTGGACCGCATCGCGCTGCTGCTGGACGCTGCCAACCCGCCGTCGCTCACGGACGAAGATGAGCGCTCGCCCTTCCACGAGTTCCTCCAGGACGTG
CTAGCGAAGGCGTTCGCGAAGCGGCTGCCAAAGCTCGTCAAGTTCCTGCTCGCGATCTACGAGCTCGAAGACGAGACGCGCGCTATGGACAACCTGACGC
TCAACCCAGCTCCGCATGTGATGACACCTGTGAAAGCGGCCGAGACAGCAAGTATCCCTCCAGCAGCAGCCCCCAGTGTCCTATCAGCACTACTGCGCGA
CGAGCAACGACCGATCAAGCGCTCGCGCACAGAGACCGTGGTCCCGTTCAAGAAGATGGAGATCCCGAACGAACTGAGACGCCGGTCGAGTTTTCCATCC
ACGCGCAAGGACCTGCTCAAGGCTGTGAACAAGACGGGGCCTGCAGCGGCGGCAACCTCAACCTCCTCGCCAGCAATACCGCGAAGCATCAGCAGCAGCA
GCCGTAGCAGTAGTAAGAGCAGGGCGACCAAGAGCGCAGAGAAGCCGAGCCTGACGCCTCAGAGCTCACTGAGCATGCGACAGTCTTCGTCTGGCTCGAA
GAGCGGTGCGCCGCTCTTGATGCGGAACGTCGACCGCGCGCTCTTCGCTGGCCCACAGTCGCGCTTCACGCCCAGCGCCAGCAACAACACGCCCCACACG
ATCGTCACCAGTGGTCTCGTTCGTCCACTGGCCGCTGCTAGCAAGCATCCGCTGCTGGCCACAACGCCCACGAACTTTAAGCCAGTGCTGCCAGGCGCTG
CACCAGCCGTGTCAGTGGCAGGAGGACGTCCCTCGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNTCTACTGCGCTGATCAACCATTTATTAACTAAACCATTTAATACAAAATCCCAGTTGTGATTGGCATCTCATAGGGAGAAG
CTCATGTGATCAGTCGCTGTCGTCGCTGTCGCTGCCATACGCCACGAGGCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTTGCTGTAGCTATAGTAGCTTTCGGTTTCT
TGTTTGTGGTCGTGACGCCAGCAGCAGACACCGCGGCCTTGCCCTTGGGCGCAGCTTTTCGCTTCGCGCGCACGACGACGGGCGTAGGTGGCTTCCTGGG
CTTTAAATATTTCTGCAGCGCTTCCTCTGATAGCACGGCGCTAGCCATGGGGCCACTAGCTGTGGTGGCCGTTGCAGCACCATTCGTGGTCTGCTGCTTG
GCGAGCACTGGCGCGTAGAACACACACAAGAGCGAGGTCATTTTAGTCAGCTTCCACCCGGCGATACTTTATTTGATAGCCACTCGCACTCACGGAACTC
GGCCACGTCTTCGTTGTGCTGCTCCTTGCGGCGCTGCTGGGACTCTGCCTGGCGCTCCTCCAGATCGCGGATGAACTGGAACTCCTCGTCGTCTAGGGCC
TTGGGCGGCGCTGTACAAACAAGTTTTCACCACACACACGTGAGCTTCAAATGATAAAAATCAGACATGCGTGCATGCCGCCGTCACCCTACCAAAGGGG
TTGTGCTTCTCCTTCCAGTCGCTGTCCTTCTTGTCTTTGTGCTCCTGCAGACGCTCGTACAGCGGTCGGTAGTCAGATGCGTCCTGCGCATGCGGCGCCG
GCGCCTCGGAGATGCGCTTCTCCTCCACGTTGTCTCCGAACAGCTACGATAAATTACGAGACGCAACGTCATCAATATGAGATCACGCAGTATAGCAGAG
GCAGCAAAATACGCCGGCAGCACAAGCGCTATGTTGTAGAGACGCACCCCATCGGAGGACGTGAGCACGGCCGTCGACACGAAGCCAGGCAGCGCGGTGC
GCGGCGGCTCACTCGCGTCCATCTTGGCTCGCAGCTTTGAATTTGTGGAGCAGCACAAAATTAATCCAAAAACATGTCCATTATTATTATGTACACTGAA
ACTTATTTTGATAACATGTATCTACTACCATAATACCATATTGTCAAGATACAAATACAAAGTTTTCAATAGAATTCTTTCCGAAACATTGCCACCCAGC
CATCTTTTTCGGTCAAAGAGCCACACGCCACCAAACGCCAGCACGAGCAGCAAGAATGGCGCAGGTCGTGCTCCGCGAGTTCCTCCTGGCGGTGGAGCGG
CCCAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNCATCCGCGAGAAGAACGCGAGCCTCGACAGAGTGCTCACGTGGAGCGACAAACCTATCATCGAGTTCGAGGCGCTCGAGCT
CATGACCGCGCTCGTGGGCGTCAACGGTGCCGTGGCGCGCGAGTTCGTGCGACTGTTCAACTTCCAGAGCACGCCCTTCGGCAAGCTCGCCACGCGGCGC
ATGAAGAAGACCGACGCGCCAGCCACCGGCGAGGACGCCATCGAGACGACTGCTGCTGTTATGAAGCCCGCATTTCAAATCCGAGAGGCCTACGTGCGCC
TTGTTCTGGCGCTCACCGCGTGTCCAGACAAAAGCGTGCACCGGTTCGCTATGAAGGAGGGTGGCGTGACGGCGTCGCTCTTCAAGAGCGTGGACGGCGA
CAGCGTCGAGATGCTCTCGCACCTCTTCGCGCGCCTCAAGGAGCTCGTGCTGCACAACGCGAGTGTAGACAACAAGACCAAGCTCGTGATCTTTAACGCG
CACTGCGTGCACCAGGTGCTGCCGCTGCTCCAGTCGGATGACGCGTCGATCGCCACCATGGCGCTCGACGTGCTTCACGCGATCTTCTTTAAGCCGACCA
GCGCGCTGTACGTTGTTCCGCAGAAGCACGCGCTGCGTCTATTCCTATCCAAGGCGACCGCCAGTGCTACTGGCAACCCGAGCGNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCGAGCCGAGCCACACGTCCGAGCAGGCCTACGCC
GTCAAGGTGATCCGCAATGCGATCGTCACCATCGGCGTCAACGAGTTCATCCGCAGCACGCACGCGCAGTCGCTCGTGGCGTCCTTTATCACGACGTACC
CGGGACTCGCGGCCGAGTACCTCCAGGCGCTGTCGATCCAGCTCGAGCCCAAGCCCGGATACCGCTGGTTCTGCA