Description :
From Genome Similarity Track
Location :
Scaffold_33:233949- 236600
Transcript NameFunction/comments
Phyci_222017hypothetical protein
Phyci_114781hypothetical protein
Phyci_27380striatin-3 family protein

Sequence
2651 bases(100 bases per row)
AAAGAAGAGTGGCGATATCGCTGCCACCATGAACATCGGCACCAGCTGTGAGCTGTCGCCGAAGTCTGCATCGACTGTCACTCCATTTTGCTCGAAAAGT
GCAACTTGGTCGCTGGAGAGGGGCAAGCGAAACTCGATGCTGTGCACATGGCCGAAGAGCTGGGCCTTGATGATGTCCGTGTACCGGCTGACAATCTGTT
TGTACGTTTTGATGTACGTCTCATTCCACATCGGCAATCCTGAATATGAGTCGATGATCGGTGGGATGTGACCGACGATGTAGGCCAGCTTCCCACTGCT
CCTTAATTCTGACAGCGATGCGTTCAGCCACTCGAATTGCTCGAACGGGTCTGGGAGTGATGAAGTGTCAGGGTGGTGATCAGGCTGCGAACACAATACA
TGTAGAATATTCAACACCACGTTATTCTTTGACAGGAGTACGATAGGGCGAATTCTCTCAACTCACCGAGTACGGCAGCGTGTTCAGTGTGATCACGATC
ACGTTGTCGTCCAGGGCGTAGGCCAGATACCCGCGGTGGTTGAACCATTCGAGGTTGGACGTTGACATTGTGCTTTGCCACGCTGCTGATATGAGTGCGA
TATTCGGGTTCTCCTCCGTTTCCGGGTCCGTCACATTCATAGTGTAGTCAGGACCTGCAGCACATTCAACGCAACACAGCAGACACCGTCAGTCACCACA
AATGTCAACACTGCCACCTCACGCAACACTTACTAGTGTCTGCATTGCCGATGATGGCCGTGATATCCAACGCCGTTCCATTGTCCGTCGCCGCGAAGTA
CTTGGCCATAATCTCCACGTTCTCCTCCACCGCTTCAGCCAGGTACTCGTCCGAAAGTTCTCCGTGCACGGCATGGTCGCCAGTGTAGAGGAAGAAATCC
GGTTCAGGTAGTAACTCCTTGGCGTACTCAAGCGCCGACACCAGCAAACTCATTGGCGCGTCGTCCCCATAGGCGATCGGAATCGAGGCTGAGTCGTTCG
CATCCAGCGACGCGGAGATGTTAAGGTGCACGTCCGAAAAGAGCAAAATGTGTCTGACGGTCGCCACCTCATTAGCGTCACCCGCAACGCCATTGGTGTT
GCTGGTGCTGGCGCTCCCCATTGAGTCGTCCACGGTGGTCGCCAAGTCCACGGACGCAGTGGAGTCGCCCGAAGAGATGGCGACTCCGAGCGTCACCAAT
GCCAGCACGCAGCCGCAGCGCAAGACCATGGAGCTTTGCTGCAGTCGGTCGAGAAATTGCCGGAATGCAGTCATCTCTGCCACGAGCGCGCAGCCCCAAA
GTGCTGGCGTCGCCCTAAGATCAAGTGAAATATACCGCGATGCGCATCATCCAGGTCAAGTTACCTTTGATGGCACCAACAAAAACGTCATTGTACCCAA
TGGATGGTACACTACTTCCCTCTCAACTCCGAAACGCCGCGCTACTGGCTGAAAATCTGCGAAAGAGTTTCAACCAATGCGCGGAGACCACCGCCAAAGC
CTGGAAACCGTTGGCTGGCGCTCCTTGTGCGCCCAGCAGCTCCGCCCATAGTGCGGGCGGGTCATTTCTCAAAGAGGCAAACAAGCAGAGATGGCGAAGG
TTACCGCGAAGACCGCGGCCGGCAAGTCGGCCGCCAAGGTGTCCAAGAAGGTCATCAAGGGCTCGCACGGCAAGGTGCTGAAGATCCGCACCAAGGTGCA
CTTCTACAAGCCCAAGACCCTGCAGCTGGCCCGCGCCCCGCGCTACGCCCGCAAGGCCGTGCCGTCGCGCAACAAGCTCGACAAGTACCGCATCATCAAG
GCCCCGCTCACCACCGAGTCGGCCATGAAGAAGATCGAGGACAACAACACGCTCGTCTTCCTGGTGGACCTGCTGGCCAACAAGCGCCAGATCAAGGACG
CCGTCAAGCAGCTGTACGACATTAAGGTCGCCAAGGTCAACACGCTCATCAGGTACACCACATCGCGTCGAGCTTTGCTGCTGCCGGACGGAGGGACCAT
TTTCGAACCCCCTCGAGCTGCCTCACAGCCTGGCCGTAGTCCTGATAGGGAAGTGCGGTGGCGTGGCCTCGAGGGGCGGCCTCCNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNC
GTGTGGTTGGGAAATGTTGGAGCGACTCGTGAAGTAGTATCGACATCTACTACGCAGTTAAGTCGGAGAAGGCAAGCTAGTCGTAGTTCTATTCCACTAG
TCAGCTGTGGGAACACAGCCATTGCTACATCACTTGTGGCTCGCTTGCTTGCACAGCGAGCGGAGCGATGCTAGCGTCTTTCAGGGGCTGAGCTCACTGG
AAGATCTTTATTGTACTGTCCGCGCCGCCTGTGGCGATGAAGTTGCGAGTC