Description :
From Genome Similarity Track
Location :
Scaffold_98:233924- 238114
Transcript NameFunction/comments
Phyci_95629ribonuclease BN

Sequence
4190 bases(100 bases per row)
aatatagaaaaatgtgagccagcgtaacctgtgaagcatacaatttcaaatagtggcgcgttgacaatccaataattacaccgagtctaatcctagatgc
ttatcagcgacgttgtttgcgaaagcgtatctcattcgcgttacggtggagagcttgatcctattggccaaaagtgctgtaaatatcgcttgctaccctc
ctcgctcttccccacacaatcatattcatcaggtacccagcaagacaggtacgtcgccatgaccacccgcccaacccagttcaccccttgtagcatttca
atagatatgccagcacgtggtcaccttggtggagacgaagtccgtagcgtctgtacagcaccggacacgaaaaaagcctacacaagctacaccaatggca
tcactacatggatcaaagcgacgcagcaatgtccatacattttgttctgtgctgacggaagtctcaatcttgatgtgtttctccctggacatgctggggc
ttttcgattgcataaaatgaatgagagcaagaccaaggtaactacgctTAGTGTGCGCTGCTTTCATCATTCGTTTTTCGCTATCATGACATTTTGAATC
GACTTAATGCGATGAttagtacgggtagccgctcgtgaatgcgtgccacaggcattcccctggacgtcgaactttttcagcagcaccaagagactcgcag
atcactgaactagcttccagacgtactgatcgatgggttcgctacactacttgaagaaaagtgtgtgggccagcacaatatcacgagggaaaacataagc
tccacgattcgcgacctcctgtaggaggctgggctgtggcgtgcacacgatggaatccagcaaatgacagcgcaatctgacccatgcaacatcgtgtacc
attagaaatccgatgggcgctccacaggatgcccgaagcactcatctttccacagctagatgcgctaagcgtgtggcgcatttggtgactcggtcatcct
gccgtggggtatcctccattcagagcactgcagccgtctgattttaccaatccaaccgcaaagtgttttccgaatggacagtactagtacgccacattgt
ggctggtgtcgaggcaagcacaggacaatcaatgcaaagaccgtcttctcagcaggctgcagatgatttataccacggtggtatggccaacatcccgtta
aaacagcctggtcacgccgagaaacagcgcccggatcgcgccgagaaacagcgcccggatcgcgccgagaaacagcgcccggatcgcgccgtcacaactc
tgcggcgaatcaggcaagccatccaggaagccaacccagaggcccgacgtgttccatttcgcaccagaaaccgtgctagggcaaataagtagaagctagt
ctgcaagttaacgctgtcaacaacacgcaaagcacccatgttagccacaataaagcacagatcgtcgcagcttaccttccgcctgctcgctagcgtgcaa
tttctattctgagtattagccaataggatctcacgtcgttgttgtatcttgtctgtgttacccgatctcgacacaagtcaATATTTTGCGGTTTTTGTCT
CGCACTGACAGAGTAAAAATCATTTGGCTAGATGTATTACGTTTCGCTCGCATCTGCAGTACACCTCAAGTCGGCACCCAAAACGTGGTGAGAACTCATC
AACACCGTCGTGTAACTCATCCGGCTAAGACTTGCCAGTCGGTAGAGCTCTGTGTCTTTCCTTCGAATTGGTTGCTCCCATAACCTGAACCAGACCTTCG
AAATCGTGCAAGACATGGGTGTGACTGAGATCGTCTCGATTCAGTTCTAGCTCATGTAGTCGCGTATCTCGTGATGTTTCTTGTAAAACTAAACCAGAAT
AGGATCCCAGGAAGCGCTGGAAAGACAGAATCAGCTTGAAGATATAGTTCCTACATGCAGTCTGCTACCTTCTCCAATGCTTTTAAGAAATTGTCCTCGC
GAGTCGTATCCAAAACGTGACTAGATTTCGCTCCCCCAGGAATACAAATTATTTCCCCTGAAAGTACAACAAAACAATATCGTACATGTCGACATAGCGA
TTGAGATTAATCGCAGAACTATACATCAGCAATGCCAATTCTCGTCGCGAGCTTTCGAATGCTGACAGCTCATTGAGTCGGCTTGGCATACCATCCGTCA
GCTTTTGGTTTGTGCGCTCGGAGCATTGGCGTTCCTTGGGCGCGGTTTCAGCGATCCTACACCCCTTTTCCCATTTCTCCTCGGTCGAAGACGTAACTTT
CTCAACGTGCTGTTGGCGTAGCGGAGCCGGCTTTTCGTCAAGGCCCTGGGCTTCCGGCCGCAGCAATACACGCTCCGTTCTCTTACGGCGCCGCACGTCT
GTTGCGTACGTGTAACCGAGTGCACACCCCGTTGTAGACGATTACGTTCATGGTTACTTCTAGTCTAGATAGATGACGCTTTGTTTGCTTTCGAAACGAC
TGGCTGCGAAAGCGCAGCAACGGCGAGGCCAAACCTAGACTAAGTAAAACAAACAAGTACACTTTTCTATATGCTTGGAGACGCCGACAATGGGGATGGT
GGTGAGAAGAAAGCTGAAAAGATTGACTTGAACAACGTGAAGACGACCCCATTTTCTGGGTTAGTCCCTCCGGGGAGTTACGTCTCTGGCGATTGTGACT
GGTGGGAGCGGTTCGCTGACCAGCTGGAAGACGTTCAAGTCCTGGTTGGGCAGCACTGGTCGTCGAGTGTCAAACAATCGGCACTGTCGATCTCCCTCAC
CGGATCCGCACGCCGTTGGCTTCAAACGTCTCGGTTGGAGCACCCACTCGTTTCATTTGAAGGAATAGGAGATTCATTCGTTGCAAAGTTTTTCCCCAAT
TTGACCGATCTAGAAGTCCCGGCCAGGATTTACGTGGGGGGCAAGCACGCAACGGAAACCTATCAGGAGTATGACTGATGCAAATGACTGATGGACTGAC
CGGTGGCGCCGCTAACACGGCTAACGTTCAACATGCCCTCGAGACGTTTCGTCGCCTGGTATGACCACAGCGAAAGGACATCGTTCAAGCCCATGTGCGT
GGAAAGCGCGGCACGCCTGGTAGCATACTTAATGATGCAGTCATGTTTTTGTGCGAGCTAGCGCAGTCTGACAAGCTGCGGACGGATCGCGCGGAAAGCG
CGCTGAGGCTAAACCCAAACCTGCCGACGTCAGCGTCATGCCTACAGGATCAAAGTCCAAGTTATACACCCCGGAAGCACACTCGGTCATCGTTGAGCAA
AAAAGGAAGCCAACAAAGATGCCATACGGAGGCAGCATCTTGTGCTACATCTGCTCTGAGGAGGGCCACACTGCAAAGTACCACCCTTAGCATTTGGCTA
AAACCCCAGACGAGGCTGAACGCTGGAAATGTGGCATCGCAGCCAAGGCCACGTCAACTACGATACACTGAGGAAGATGGTCAGTAGTGGAGTTGTTAGC
GGTCTGCATATTGCGTCAGGCGCAAAGCCGTCGATGTGTTCGGTGTGTGCGCTCGCCAAGGCCACAGGCAGTCAGTTCCGACCACTCGAACTAGCTCCGA
TGAAGTGGCCGACGGAGTCTGTAACATCGACCTGGCAGGCCCAATTTCAGCATCGGTGAGTGGATACAGATACTTCATGGTGGCGGTATGGCAAGACTTC
GTTCAGACGTGCGCACTGAAGCGCAAGAACGATGCACCTACATTGGTGAAGCGTTTTCTGAACATGATCGAAAGACAAGCTGATGTTTCCGCTACGTCCA
TCAAAGTGTACGCACGGACGGCGGAACGGAGTTCCTCAACAAGGATTTCAGGAAGCTGGCCCAAAATCAAGGTATCTTGATGCAGCACACAACATCGTAC
ACGTCATTTAAAAAAAACGGTTTCGCGGAGAGGAGCATACGGACGGTGACAGAAACTGCGGCTGCCGTGTTAGTGGACTCGGGTTTGCCCCACAAACTGT
GCACAAACTGTGGGAGTATGCGTTGTAGCACGCAACATACATACCAAACAGAATTCCTCGCCGCCAAGCGAGCGTCACTCAATATGAACGTATATTCGGA
CAGCGTCTCGATGTGATCCGTCTACCGATCAAGCAGTCGTGGCTCGTGTCCCGAATCAAATTCACTGCAAGTCAAAGCGCTTTGTCGACA