Description :
From Genome Similarity Track
Location :
Scaffold_291:2339- 6909
Transcript NameFunction/comments
Pytve_DAOMBR484snap_masked-pve_contig_291-abinit-gene-0.27Myosin
Pytve_DAOMBR484snap_masked-pve_contig_291-abinit-gene-0.25Myosin

Sequence
4570 bases(100 bases per row)
CGCGGACCGACGCAGTGCATTGACAAGCGCCATGGAGATCGGCACCGAGGTGTGGGTGCGGCGCGGCCGCGAGGTCTGGGCGTGCGGCGAGGTCGTCGAC
TGCGCGCCGCTCGCGCTCGGCGCCGTGCGCGTGCAGGTCAAGCTCGCGGACCGCGACGAGCTGGTCACGCGTGCGTACCGTATTGTGTGCTAACGCTCGC
TTGCCGACCGCGGTTGCTAACCTTGTTTTGCTATCCGCTCATGCGGGCGTTATGCTCCGTCCCGCCAGGTACCTACTCGGAGCGCGGCGACGACGACGAC
AAGCAGCTTTACATCCGCAACAAGCGACGCGACTTCGTCAACATGGCGTCGCTCACGACGCTCGAGCATCTGCACGAGCCGGCGCTGCTGCAGGCGCTGA
GCGAGCGGTTCGCGGCTGACCGCATCTACACGTCCATCGGCGACATCCTCGTGGCGGTGAACCCGCTCAAGCCGCTCGACCTGTACGCGCAGGCCGAGAT
CGACCGGTACAAGGCGGCGATCGCGAGCTCGGCCGGGCTGAGCGGTCGCGCGGGCCAGCTCGGCGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNCTGGAGCTGCCGCCACACGTGTTCGCGATCGCGGGCAAGGCGTTCGCGGGGCTGCTCAAGTCGACGCGGCGCAACCAGT
CGATCCTCGTGAGCGGCGAGAGCGGGTCGGGCAAGACCGAGTCGACCAAGTTCCTCATGCGGTTCCTGACATCGGTGGGCCGCGACCAGTCGGCCTCCAA
GGACCTCGAGGGTGATGTGGTCGAGATCGGCAAGCGCATCCTGCAGACCAACCCGATCCTCGAGTCGTTCGGCAACGCGCAGACGATCCGCAACGACAAC
TCGAGTCGCTTCGGCAAGTTCATCAAGATCCAGTTCGGCGAGCGGAGTGAAATCGTCGGCGCCGAGATCGTGTCGTACCTGCTGGAGAAGGTGCGCCTGA
TCCACCAGTCTCCGGGCGAGCGCAGCTTCCACATCTTCTACGAGCTGCTGGAAGGCGCCGGCGCCGAGACGCTCGAGCAGCTCGGACTCCAGCAGGGCGG
CAAGTACGAGCTGCTCAACTCGTACGGTCCGGCGTTCGGTCGACGAGGAGGACTTGGCGCCAAGTACAAGGCGCTGTTCGACGAGACTGTGCGCGCGTTC
GAAGATACGGGCGTCCACGAGGACGAGCGGCTCAACATTTTCAAGATCCTGGCCGCGCTGCTGCATCTGGGCAACCTCAATTTCTCGGTCTCGACTGCTG
GACGGGAGGAAGTCGTCGCGATCGACCCGACGACGCTCGTGAATCTGGAGAAAGCGGCCGAGTTGATGGGTCTCAACGCTGACAAGCTCAAGTCCATCCT
GCTGAGTCGTGTGATCACGGCAGGATCCGAAGTGATGGTGCTCAAGCTGACAGCGGAGCAAGCCAAGGATGTGTGTCGATCGCTGGCGAAGGCCATCTAC
GGTCGGCTGTTCACGTGGCTTGTGCGGCGTCTCAGTGACGAGATTAATTACTGTGATTCGACCATGGGCGACTCGGATGATGACGTGGCGACGATCGGCA
TTTTGGACATCTTCGGCTTCGAGAGCCTCGAGCAGAACGGGTTCGAGCAGCTCTGCATCAACTACGCGAACGAGCGGCTCCAAGAACAGTTCAACGAGTT
CGTGTTCATCAAGGAGCAGCAAGTGTACATCGCCGAGGGGATCGACTGGACGTCCGTGTCGTACCCGAGCAACGCTGCGTGCTTGTCTCTGTTCGACGAC
AAGGGTAACGGTCTCTTTTCGCTTCTGGACCAGGAGTGCTTGATGCCGAAGGGCTCCGACCAGGCTCTCAGCACCAAGTATTACCGATACCACGGCACCT
CGGAAGATGTGGCGACGCAAGCACACCAAGCGACGCAGAAGTACACGCTGCCGCAGTTCGTGAGCTCGTTCGGTCGCTTGTTGCGCAGCACGTCGTCTCA
GGAGATTGAGGACGATGAGCCGACTGTGGACACGAGGAAGCACCCGTTCTCAGCATCCAAGATGGAGCGCGTCAACCACCAGTTCGCTATCCACCATTTC
GCCGGCAAGGTGCGCTACGGTGTGCAGCAGTTTGTGGAGAAGAACCAGGACACACTGCCGACGGACGCGAGCACCATCTTCAGTGGCTCGTCGAATCCTG
TCGTCGTGTCTATCGGAGATACTTTGCTCGTGGACCAAGACGCTGAGAACGTTCCCGGTCGGCGGCGGTATTCCATGTTGCGGTCTCCGAGTGTGTCTTC
GCAATTTCGAAACCAGCTGGATCGCTTGATGACGCAGATCGGCAAGACGGAGCCGCACTACATTCGGTGTCTGAAGCCGAATGAGCTCAAGAAGCCTGGC
GTGTTTGATCGAGAGCGGATGGTTGAGCAGCTGCGGTCTGTTGGCGTTTTGGAGGCACTTCGCATAGCCCGTGCTGGGTACTCTGTGCGCCTTGCTCACG
CGACGTTTGTCGAGCTGTTCTTCGCATTCCGATCGCTCCTCCCAGCCAAGGATGCGAGCTCAGCTAAGTCCAGTCAGGAGTTCGCGCAGGCACTGGTGAA
TGCGCTGATGGACAAGTACCTGTTGGAACAGGGTGTGAGCAATCGGCTGAGCAGTTCGAACGCGACAGATGATAGTGGTGACATGGCCGAGCGGCGAGCA
AAGGTCGATGCCAGACGGCGGCGCGGCGTCCAAGTCGGCAAGACGTTGGTATTTTGCAAGACCGACGCCTTCAACCGCTTCTCGCAGTATCGCGTCGCTC
TCCGTGAGCGATCCGCGCTGACGATTCAGCGGTACTACCGAGGATGTCATCGTCGTCACATGTATCTGGAGCTCAAGACAGCTGCAGTTCGTGTGCAGTG
CCTCGTGCGCAGCTATATGGCGCGAAAACTGCTTGGAGAGCTGAGACGTCAGCGAAGGGAAGTGGCGGCGACGCTGATTCAGAAACAGTGTCGGAGGTGG
CAACAGCGGCGAGCAACGGCAGCAACATTGATCCAAATCCAGTGCCGGAAGTGGTTGTCCGAATGTCATCGCATCACAGCGGTTGTGCATGAGTTCCAGC
TGCGGCAAGCGTTTACGAGTTTCAAGCGCGGATGTGAAGCCTCGCGTGCTGAGGCGGAGAAGGAGCCATCTCCGAACGAAGACTCTGGTGCAGAACAACC
GTTGAAGATGGATATTGCTGTTTCCAAGATTGTTTCGGGTACTGCTGAACCAAAGAGCACTTCGAGTTTGGAGGAAGAGCCTGTGACGGGGGACAGCAGC
GACGGAGGTCGACCGCCGCGAGCGCGCCGACGCACCAACAGCCGCGTCCAGTCGCGTCGTCCGCGTGTGGGGAGCGATGCAGATGACCGGAACATGCTGC
TGGAGAACGAGATCGTGCGTCTGCAGCAGTTGCTGGTCGAGAGCAAAGCGGAGACTGCACAACCAACTCGACGACGCGGGTCATCCATTTCTGGCCGTCC
GCCGACTGCCGGTCCATCTCGATTCGCGCTCCATGAGGCGTCAATCCCGCGGCCGCCACCCCGCCAGGTCAAGAGTCGACGGAGCTACTCGGTCGATGGA
GCGGAGTTTTCGGGTGACGATGGCGAAGGAACCGATGAGCTGACATTGCTTCCAGCTCGTCGCACTCGCAGCGTCATGCCGCGCCGCCAGATGGACAACG
TGTCAGCTCTCACACAGAAGATCGAGGAGCTGGATGCCAAGTGCAAGTTCCTGGAGCAGATCGTGGCGCGGAAAACCTTTGACGACCATTCTAGTGCTCC
GTATGGGTATCGTGGCGACGCGTCCATGATCGGTGGACCTGGATGGGAGAACTCGTCGATGGACGGTTCAGTTTACGGTGACGCGCCGTTGAGTGACAAT
AGCGAGTCGGGGACGGGCGTGGACTCGATCATCGCCAACATCCAGCAGCAGATGAACTATCTGCGGCGGTCCATTGCAGTGAAGGAGGAGGCCGTCCGGA
CTCGGAAGGCGCACGCCACGTCCGTCTCGTCGAGCACTCGTCCGACGCGGTCGTCGTCGGTGGCGTCCTCCACGTCGTACTCGTACTCGGGGATTCCTGT
CGACCGGCCGCCCAGTTTGCACTCGCTGACCAACTCGAACGGCTCGCAGCAGTCGCACATGTCGGCACTGTCGCCACACGCGCATGGTCGGCGGCGCAGC
TCGATGGCGTATCCTGCGACTCCGACTGGATCGTACTACGCCGGCTCGACACGGTCGTCGATCGGCGGCAGCCGCCCGCTGCCTCGGATTGTGAAATGGG
CTCGCAGCAACAACTGCTATGAGTGCGAGGAGCCCTTCAACCTGTTCGTGCGGCGTCACCACTGTCGCATGTGCGGCAACTCGTTCTGTCACGGTATGTG
CTGTGTTGTTCACCCCACTTGATCGTTCATAGCTGACTAATATTGTCGTGTGCGTGTCTGCAGAACACTCGAGCCGCCGCCTGTCGGTCTTCGGTATCGG
GTTCGACGACGAGCCCGTGCGCGTGTGCGACAACTGCTTCGCGGACTACGCGGCGTCGCAGGACCCGTAC