Description :
From Genome Similarity Track
Location :
Scaffold_188:2339- 4748
Transcript NameFunction/comments
Pytve_DAOMBR484maker-pve_contig_188-snap-gene-0.12Charged multivesicular body protein 5
Pytve_DAOMBR484maker-pve_contig_188-fgenesh-gene-0.1ATP-binding cassette sub-family F member 2

Sequence
2409 bases(100 bases per row)
CGGTGCGTACAGTCGACCTCTGTTCAGATACTCCGATTCTGACATTGCTATGCGCTCGCAGCAGGATAAGTCGTCGCCCAATTCTGTCAGCAAGCCGCAG
CACGGCGGCATCTACCGCATGCTCCGCCGATCGAGTGGGAATCGTTAATTCGGGGACAGACCATCCTCAGCTTCAACCTAGCGAGAATGCATGCGTATCG
TTGTTTTGGGATTTTGGGCTACTGGATTTTTATGGATACATCGCTTAAAACGGGGACATGGGGACACGACCCCCTAAATAGGATATATTGCCGATTTTCT
TCTCGGAGAAAGCAAGCATTCCGACGGCATCATGGATCGGATATTCGGCCGCAGGAAGCCCGAGGCGCCGACCGTCAACGTCGCCGATGTGAGCACCAAG
GTGGACGGCCGCATCACCGACCTGGACCTAAAGGTGCGCCTGCAGCTGCTGCTCGATTTGTGGCGTCAGTTCGCCTGCGCACCCGCTCGCATTGCACATT
GTGTTCGCTCGTTGTCGCTGACATGGTTCGTTTGGAAACCGCCGCGTGCAGATTGACAAGCTGGACCAAGAGCTGCGAAAGTACCGAGAGCAGGTATGCG
TCGTACTATTGCCAATGAGAGTATGCGTTGCTTGGGTATGGGGGCATGACGGATGTGATGGTGTGCCGATAGATGTCGAAGGCTCGAGGGCCAGGTCTGA
ATGCGATCAAACAGCGCGCGATGCAGACGCTGAAGCGCAAGAAGATGTACGAGGCGCAGCGCGACAACTTGACGGCGCAGTCGTTCAACATGGAGCAGGT
TCGTGCCTTCGAACTGTGGTGTCGAGTGGGGTACAGCTACAAACTCAGAGTGCTGCTGTTCAGGCGTCGTTTGCCATTGAGACATCTCGCGACACGCTGA
CGACGGTGGCGGCCATGAAGAGCGCGGCGGTGCAGCTGAAGGCGGAGACCAAGAAGATCGACTTGAACGAACTCGAGGTACCATCGCTCGCTCGTTAGGT
GTTGGTGGCGCGGTCGAAAAGCTAAGTGGAAGTGGTTGTGCTTGACCAGGATGTGCAAGACGACATGGCCGATCTGCTGGAAGACATGAACGAGATCCAG
GAGATCATGGGGCGGTCTTACGGGTGCGTTTTGGTCCAATTCTGTACACGATATTGGGCTTTGCCTGGCGGCTGGCTGCTGATGCGTGGTGTGTTGCTGT
GGCGCAGGATCGGCACGGACGTGGACGAGAGCGAGCTGGAAGCGGAGCTCGCGGGACTCGAGGATGAGTGGGCTGCCGAGGAAGACTCTATCGCGGCCGA
GGCGGAGCAGACGCCGTCGTACCTCGCTCCTGCGGCTCGCCACGATCTNNNNNNNNNNNNNNNNNNNNNNGTCCGGCGGTCTGGCCAACCCCACTAGACG
GACGACCGACGAGTTTGGTCTGCCGATTGCCTCAAGCACATGAGGAGGATAGGGGATGCGACGGTGAACGCGGAGTGATTCCTGACATGTTTGTCGTGTC
TGATTTTTGGCGGGGCGGCCGTCCTTGGCGCAGTCGCGGAGATGCAGGCAAAGAGGAAAGTCGACGATGATGGAGCCGCCAGGCGACATGCGTCACTATA
CTGACCAGATCGAAGAGTATCCGGATAGTATACGTCGGTTAAACCCGCAATGCGGGAGCGGGGTAGGGCTCGCTGTCTGCTGTCGTCGCTGCCGTCACCG
GAACTTCAGACTTGTCTCCGATTGGCGGGCAGCTCAGCCAGCCAATCGTTTCATTTCCTATGCTTCACACTCCATTCGAGAGGATACGTATTTACATAGT
TATCTGAAGGATGGATTCGTACTCAGGCATGCAATGCACTTGGTGCCATTTACAAGGGTTATCGATTGATACTATGAAAATGAGGTTTTACATTTGCAGG
TTTTTTAGTCTCCTCACTCGCACCCCTTGTTGCACCCCTATCTAGGGGTCAATGGCCCCACTCCCTCCCTTGGACGGGTCTGTGGCGGGTACAGTTTTGG
CTGCCAAGCGCTGCCTGCCACTTGCCCATTTGCGATCGTTGGTGGTCCGTCGACCCCCAACGGTAGTCGCGAGCTCTTCCCTCCCTCCCTCCGCCCTCCG
CCCGCGTCCCACCAGCAGCAGCAGCCATGCCGCCGCGCGTCAAGAAGGAGCGCCGCGGCAAGAAGGAGTCGAAGAAGGCGGCGGCCGAGGAGAAGAAGAA
GGCCGACCAGGCGGCCGCGCTCGAGAACATGTCGGGAGCCGACCGTCTGGCCGAGGAGGGCATCATCGCCACGTGCTCGCACAACGTGCGCGCCGTGCAC
CGCAACTTCAAGGACATCAACGTGCTCAACTTCAGCATCACGTACTTCGGCAAGGTGCTGCTCGAGGAGTGCGACGTGTCGCTCAACTACGGCCGTCGCT
ACGGTCTCA