Description :
From Genome Similarity Track
Location :
Scaffold_1696:2339- 3787
Sequence
1448 bases(100 bases per row)
CCCGACGCAGACGAGCTTGAGGAAAGTGCTGCGGGCGGTGGATCGCGCGAAACACCGCCAGAAGAAGGCGGCGATCGGATCCGGCAAGTATCGCCAAAAG
GCTCCGACGCCTACGGCCCCAGCTCGACGTGTTCACCAAGTCACGGCGCCCGACTCAGGAACTGAATCAGGATCCGACGGTTCGGACTCCGACCCTGAAG
ATTACCGTCGGGTCTGTCTCACTGCATCCAACGATCGAACGGCGACGACAGGAGACAACTCTCGACCGGGGGATACCGTACCCGAGGACCGTGGGATGTA
CAGATCCCGAGATCTCATGGACGGGGCAGCACAAGTCAGGTGTTCACGGTGCGGATCCCGGAAGCACACCGAATCTGGATGCTGGAAGCAGCTGGTCTGT
GAGAAGTGTGGCAAGAAAGGTCATCCCGGGGATCATTGCTTCTACGTGTGTCGCGGGTGTGGCGAGATTCACGACGTCGGCAAGTGCCCGATGGAAGAAT
TCTACAACCAGATCCGCCAATGGTTTGATTTAGCCAAGCACCGAGGGATGTTGCCAGAAGTGGCCGAGAAGATGTTAAACTAGGACGTTCGCCGGGTTTG
AATCCGGTACGAGCCGAGCGTTCTAGGTATTGCATTTATGCATTTGTGAACAAGACATCGCTAGATCCAGGTAGCAGGACCCTAGATCCAGTCGATAATA
CATGTGATCTACATGAAGTGTCGGTTGCCAAGATGCTTCAAGTGGATGAGTTTGCCAGATCCGAAGTTTCTTCAACCCTGGATCTACAAAGGGGAGAGGC
ACGTGGTTATTGGGAGAGGCGCCAACATGGCCGATGGTTTGAGCCTACCAAGGGTGAGGTCACTGCAGATCCACCTAAGGTCTGTCAGGTCACTGGATCC
CGTGGATCTGAGGATGTTGGATCCATGGATCTGCTAACCGGGGAGTCCCGTGGATACTGGAAGTACCATGCCCCAGGAAAGTGGTTCAGACAAGCCAAGG
TAGGGGGCAAGATCAACAATGAAAAAGCAATTCTACTCCTAGATAGTGGTGCCGAGGTGTCTATACTAGATACCGCCTTTGCTCGTAAGGTTGGGTGCCA
AGTGGATGGGAGTCGGATCCAAGATTGTGTTGGGATTGGTGAAGGCGTATACCGTACGAACGGGAGAACGCGAATCAAGATCATGTTGGCAGGTTGTTTG
GTGTACTGGTTTGATATTTGGGTTGGAGATCTCGCTGGTCAAGACGCCATCCTCGGGATGGATTTCATGGTACCAGCCGGAGTGAGATTGGATTTGGCGG
ATGGGACACTTTGTTTCCCTGACGAGATGTAGATCCAGCTCAGCGGACGGCGGCCGTTGTATGGAGCGAAGATGAGGATCATAAGGGCGGATAAGACAAC
CTGTATCGAGCCCGGGGAGACCTGGGAACTGCCAGATCGGTTAATGTG