Description :
From Genome Similarity Track
Location :
Scaffold_156:2339- 3471
Transcript NameFunction/comments
Pytul_DAOMBR144PYU1_G015000Similar to ABCA1: ATP-binding cassette sub-family A member 1 (Homo sapiens)

Sequence
1132 bases(100 bases per row)
AGCGTGGCGAATGTTTTGGATTCCTCGGTATTAACGGTGCAGGCAAGACAACGACGATGAAGATGCTCACTGGCGACGTCGTACCATCGAGCGGCAGTGC
GACGCTCAGTGGTTTCGACATCTGACCCAGCAGATCGAGGTGCGCCGTCAGATCGGGTACTGCCCTCAGTTCGACGCTCTGTTTGACTTGCTGACCGTCC
GCGAGCATTTGGAGCTGTTTGCGCGCATCAAGGGTGTGTCGTCTGCAGAGTTGAATGACGTTGTAGCAGGCAAGATCGAGCAAATGAACCTGAGCTCGTT
CGAGCACAAGCTGGCTGGCAGTTTGAGTGGCGGTAACAAGCGCAAGCTGTCCGTGGCAATTGCGATGATCGGGAACCCTCAGATCGTCTTTTTGGACGAA
CCGTCGACGGGTATGGACCCTGTGTCGCGCCGATTTATGTGGGACGTGATCGCGGACATTTCGACGCGCAGCAAGTCCTCGACGATCGTGTTGACGACTC
ACAGCATGGAAGAATCGGAAGCGCTGTGTTCTCGCGTCGGCATCATGGTCGGCGGTCGTATGCGTTGCCTGGGCAGTGTGCAGCACTTGAAGAGTCGATT
CGGCGATGGTCTGGTGCTTGACGTGAAGCTGGCGACGTTGACGCCAGAGGAACTGCATGCGATGGTTGAGCAGCATTTCGGTGGTGGCGACACGTACTTG
ACATCTGCAGACCTGAAGGAAAAGTGCCGATCGTTTGGCAACGCGAAGCTGGCAGAGCGTGTGGTGGCGTCGCATCCGACGGGGTACAACCTGGCTGCGA
CAATGGAGCGCGACGGATTTGTGCGCGCGGAAGCATTCTGCTCGTGGTGCGTGGAAGAGACGCGCTTTGATGTATTAAACGAGTTTTTGAAGAAGTCATT
TGGCGCGGATGGCGTGGTCGTGATGGAACGCCAGAACGATTTCTGTCGCCTCAAGCTGCGTGGGTCGAACGACCAGCTCAAGCTGTCCAAGGTGTTTGCT
CTGGTTGAGAGCGTGAAGACAACGATGCATGTTCGCGAGTACAGCGTGTCGCAGACAACGCTGGAGCAGATCTTCAACCAGTTTGCGTCACAGCAAGCGG
AGGAGCAGGGCGTCGCTCGCGGCATGTACCAG