Description :
From Genome Similarity Track
Location :
Scaffold_4:2338698- 2341127
Transcript NameFunction/comments
Phypa_INRA-310PPTG_03635hypothetical protein
Phypa_INRA-310PPTG_03636GAF domain-containing protein

Sequence
2429 bases(100 bases per row)
ACCAGGAAGAGTCTGGGGGACGTAGCGGAAAGTCTGGAAAAAGTAAGAAGGGCAAGCGTGGGTCGAAGCGTGGCGGAAATACTGATGACGACGAGAGCAA
ATCAGCCTCTGCCCAAGTGTCTATCGTGCCTTTACGTGAGGAGATTATTGAGCTTCTTGTAAGTTGGTTTCCTGCCGTCGAGGACCTCGAGGGCGATGAC
GACTTCATGGATGGCATGGCATCGTACTTGGGGCCGAAGATTGACGAGCTGTACTCCACCGCGCTAACCAAGGCTCTGTCTAGTATTATCCGTGGCGACG
CTGCGTCGCTACGCGAGTTACGTAAGGTGTTCGAAGACCGATTCGATGAGCAGTTCACCAAGCTGCTCATATTGGAGAAGAGCTTTAACAAGCTTTCGAT
GCACGTGGATGCCAAGGATGCTGCTGGCATGGAGAAGCTTGCTCTCGTGGAGACACATTTGCTTGAATCATCTGCTGTGGAACTTGCTGCACTGGTGACT
AGCTTTATGGCTGAGAGCAACAGTCTAGAACTAGAAGGCATGCCTCTTTTATCGACTCCCAATGGTAATGAAGAGGAAGGCAAAAATGCAGCTACTCCGG
TGACGTCGCTGAGCGATGAGAACAAGAAGGTGCTTGAGTCCAGCCTTCCACAGTCCACTGCGAGTGCTCTGGTGCGGTTATGGACGCTCGCCACGGCTGG
CCGTCGGTCGTTAAGCGATTTTACGGCCCACGTTCCAGTACTGGCTGAGGCTCTCAGCATGCCACTTCGAAAATTGGACCGGAAAAAGGAGCGCCAGTTT
ATCTTCGGCTACCGACAAACAACTCTTGCGGAACTGGATGATAAGACAGCGCAACCGATCGAGAGCAAGCAGCAGTATGCTCTGGTAGCAACTTTGATTC
TGCAGCTTTTCTTCCAGCAACAAACAGGGCTTCCGGGCAGCTTCCCACGCGACACCGTGGCGTACACTGGAATCGTGCTGAAGGCATTCGAAGATTCTGT
GCCGGAGAAGGCGATGTCTATCATGCAGGGACTCGTGAACGTCACGAACGCTATTGTCGTCGACGAAGATGAAGAGCAAAAGAGTACTTGGAGTGAGACT
CTGGACGCTGCGCGCGCGTTGGTTCTGCTGAAAGACCTTAACTCCGTCGAATGAGTCAACAATTAACTAACTACGCGAGTGCCATATGCGTACAACTCGT
GGCTGTTTGAAACCTGGAATGTACGTTCTGCATGCATTTTGATCTTTACTCACAGATCTTCTCTACGTGATCGTTCATTTTGTACTTGTTTATAGTAGTT
TAATCTTCGGGTTGTTTAAACATCAGCGGAGTCTTCACGCACTGCTCGATTCTCGGCAGCACGTTGAACAACACGTGAAGCTGTGCTGGCTAGACTGCTC
ATGGCAGCGTACTGCGATCGTGTGAGGTCACGGGCATGCGGATCGGCACAGCACACGGAGCCGATGACCGTCTTGCCGTCCGACCCCATCAACGGGAAGC
CGCAGTAGAAGTTAATGCCCATCTTACGCACACTCGACATGGCACTGAAGCGTACATCGGCCTGGACGTGACGCGATACAAGTGGATGGGGGTCCAGAAT
GGTCTGTGCGCAGAAGCCCTGCTCTCTCGGATACGACATACCACCAGGTACTGCCGGATGAGTGGAAGCCAGCACATGAAGCTGAGCCTTGTCAACGACA
GTAATCATGCTCACAGCGCAGGCAAGCTCCTTCGAAGCCAGTGAGCAGATGATGCCAAGTTCAGGTACGTCGCCGAGTTCATTCAGCTGCTGTCGGCGGA
TGAGTTCTAGACGCTTATACTCGTTAGAAGGGATCGGTGGAATGATCGCTTCCATCGGGTCTTGAGGAAACTCGATCTGGTAGCTTCTCGAGTCGGCATT
AGCAAGCGGATAGTCGTCTTCCCAGCGTGGCGACTCGCCCCACATTCGTTTGAGACGCTCCACATCATCAATTGGTTCGTCGTCGGTTTGTTCAGTTTCT
CCATCGTCAGTCTCTTCGTCACGTTCCCCGAGTAAAGGCAATCCCCTTTTCGAGACTCCTGCTGACGCACTACGGATCCTTGCAGTGCTTGATCGTCTCC
GAGCGCGCTCTTCGTCTACAATATCCTTCATGACACTCAACACGCTGGCTTTACGTTTGCGTTGAGCTTCGCCACCTGCGGTTGCGTCTGCCAAGGTCTC
AAGCAACAGATCATTTAAAGACGCCGGACGTGTCTTCAGTGTGGGTCGAGTGCGTCGAGAGCCAACGCCACGAAGACTGCCACCTGGAGTACTGTTCGCA
CGGCCAATCGGAGACTGCGAGTCTGAAATCACTCGCGCTGGACGCAGATCTTCCTCGGTTACTGCGGTGTATCGAGCTCGATCCACACGAACGAGGCAGC
GTTCACACACTCGAACCTGTTCGATCTGT