Description :
From Genome Similarity Track
Location :
Scaffold_360:23384- 24794
Transcript NameFunction/comments
Aphin_H310_12593Amino Acid/Auxin Permease (AAAP) Family putative

Sequence
1410 bases(100 bases per row)
TCCAGGATAGCCCTACCCCGCGCCCTTTCGCCCACAACTCGCATGGCATCACTTTTGCATTCGCTCGCAAGCCACGATGGGGAAGCCATTCCTGACGACG
GAGGACTTGAAGATGTCGTTTTCACTCTTTTGCTGCGTCTACGGCATCGGGACGCTCAGCATGCCGGGGAACTACGCCAAAGTCGGTTATGGCTGGGCCA
CTGCTGCACTAGTCTTCATGGCTGCCGTCAACATCTACGGCACCGTGTGTATCTCCAAGGTGCTCTTGGACGCCCCCAAGAGTGTCCGAACGTACAGCGA
TTTAGGCCAGTTTTGCCTTGGGGCTCCGGGTCGATGGCTGGTCTTGATCACGCACATGCTGACGTGCATCCTGGTCCCGATTGCGTTCTTGGTCCTTGGT
GGCATTATCTGTTCCATCTTGTTTCCCGACTCCTATGAAGTTGAAACGTGGATTGTGGTCATGGGGTTGTCGCTACTTCCCGTGTGCTTGATCCCGACGT
TGAAAGAAGGTGCATTCGCGGCGGCTGCGGGGGCACTGGGCACGGTCTTGGCCGACGTCATTGCGCTCTACCTCTTGGTCGACAATATGAGTCCGATTCC
GGCGGGCGTGAGCACGCCGTCACCGATCGTCACGTTTGACCAAACAGCGTCGGTGTTCGGAAGCTTGGCTTTGGCGTATGGCGCGGGCATTGTTGTGCCA
TCATTGCAGCGCGAACACTCGGAGCCGGAGCGCATGCCCCGTATCATCTACTTCACGCTGGGACTGATTTCCGTCCTGTTTATGGCGGTCGCGATCTCGG
GGGTGTCTGTCGTCGGATGCCAAATCCCCGGCAACTTGCTCTTTTCGATTGCTGGGGCTCCCACAAAACTCGGGTTCACGGCCAACCGAGGCGGCGTCAT
TTTGGCAAACCTGTTTATGCAGTTGCACGTCACGATTGCGTTTGGTGTGATTATCACGCCCGCGTTCTACATCTTGGAACGGCTCGTGTTTGGGCTGCAC
AAGCACATGGATGCGCTCCAGCCCATCGAAGGCGGATTCGAAGCGGCGGCGACCCCCGGTGACGACAAGCCCGCGGAGTCCTTGAACAAAGCGGACATTG
TCGCACCTGACGACCACGATTTGGACTCGCAAACGTATCGCCAACCGGGCGTGTATCCTAGGGTAGCGGTCCTTCGAATTTTCGTGGTCGCTGGCACCGT
CGCCATCGCGTGCGTGTGGAAGGACCGTCTGTTGGACTTGGTTGACTTCACGGGGGCGTCGTGCATTGCCCTCTGCTGCATGATCCTCCCGATCGTGTTT
TACCTCAAGCACTTTGGCAACAAAGTGAACAAGCTCGAAAAGGCGTGGGCGGTCTTTGCCATCGTGGTGTCGCTCGTCTTGGGGGGGTACGAGACGTACC
AGAAAGGCAA