Description :
From Genome Similarity Track
Location :
Scaffold_47:23383- 31558
Transcript NameFunction/comments
Phyke_g2386hypothetical protein
Phyke_g2387hypothetical protein PHYSODRAFT_316511
Phyke_g2388conserved hypothetical protein
Phyke_g2389hypothetical protein PHYSODRAFT_354938

Sequence
8175 bases(100 bases per row)
GCCATGGCTGAAAAGTCACAAAGTGAAAGTCAAACCAAAGACTCAGATCTCGTTCATTTCAGTTTTCGTGTACTTCCTCGCAGCATCCTAAGGAGTGACA
AGATTTATAAAGCTTACTACAGCGTCAACCATATCATGTCGTTTGAAGGTATCAAGAATCTGCTTGAGAAAGAACTGGAGGATATCTCCGATGCCAGTGA
GCTCACGAACAAAATTCTGGCTCTCTTCATTGAGGAAAAAGAACCAATAGGTGGTCTCTATTGCGTCGAGATCACCAAAATGACCTCTACAGACCCAATT
GTCTTTACTCGCAACAATGAAATTACGGACAAGTTCGCCCTAATCAAATTTGGCCGTACTGAGAAATTCGATAGGCAGTTTAAAGAGTTCAACTTCAAGT
ATCGAGTGATTTTTAAGAGAAACTGGGACAGCAACGCCGAAGCAaagttcaagaagctcgtTCCTGTAAATTTCAAGAAGTTTTACTTCCCCAAAGCAAA
AGTCAAAACAATAAAGAACCAGTTCAAACTCTGTCGCAGTCCAGGTCCCACGGAATGGCGTATCATCTCTCGCGCTGCGCTCAATCGCTTGGAAGTGTTG
ATGAAAGAAAATCACCTAAACTGGTTCAATTACAGCGCGGAGATGCCGAACATATTTAATGACGAAttgaagatggagaagggAGAGCTCGAGCTACAAG
TACCGGGATTCGAAAGAGCGAATTTGCAAACGCTCATTGTCAAGCATTTCAGGGACGAGACGACACCAGACACTGACGCAAATGATGGGGCATCGGATGC
CAACGAGACCGACACGGAATCGGACGCTTGAAAATTTTCTGACAACCATCCCCAAGAGGATGTCACGGCGTCGCATATCAATAAAGCTTATAATGAAGAG
GAGTGATATAAtgtgtgctgctcgttgCCAATTGTCGTTATGTTGACTGTGAAGGAAACAGAATCATAAGGTTTACAGATTGGGATAATAAAAAAGTTTT
ACTTTTCGCTTTAAGGCCTATTTTGTATATTTGTTGTGGAAAGTACTCTGTTTATCCAGAAGTGTATCAATATTGCGATTGATCACAGTTTTCTTCTCTT
TGCTTAAATTAGTAGCTGTGTGTGTATTTACCTAAATTCAGATCGGATGCCACATTTCGAGCGTTAAGGAGGATACTGTTGAATAGGTTATATCAGTTTG
GATTGTTGAAGTCGTTGAATTGAGTGACCATCGTCGACACGACCACATTCTATTGTCCACGTATCCTTACTGGGAGTCCTAGTACCGACACTGTGTTCGG
GTGAACATCTACCATTGACAATTCATTGTCCAACCAGTGTGTTTTGATCCAAATAAAATCGATCCGATAACAGGATCATCACTTATCAAATCCTCACAAC
TCGTCGTGAGCATCATAGTCACCccctgcagcaccaccgtcGTCGAAGGCGTCCACGTGCTGGCTGCTCTGCAAAGCTTGCACAATATCCTTTTCAATAT
CCAGCGGCGACGTCGTGGTGCCATAGCGCTTAAACGGTTCATGGTTCACGATCAAAAACTTGGTAAAGTTCCACTTGATGTCGTTCGTGACGAAGCCGTC
GAGTTTTATCTTGAGGAACTTGAACAGCGGGTGTGTTTTGTCACCATTCACGTCCACCTACTCAGCGAAACTCGTCATTATCTTCCACAGCCAATACAAA
CAGCTACCAATTGGTACAAACCTTTGTGAAGAGGGGGAACGTCACGTGATACTTTTCCTCAGTAAACTTGAGGATCTCATCTGGTGTCCCAGGTTCCTGT
CGACCGAACTGGTTGCACGGGAACGCCAAGATCATCAATCCATCATCATGGTGTCGATCGTAAAGCTCCTGCATCCAGTTTGAAATGCAGTATTAGTACA
AAGCAAGTATAGCATCATAGTAGACGATCTATTACAACCTGTAGCTCTCGGTAGTTCTGGTCCGTATAGCCACATTCACTGGCCAcgttcaccaccaaaa
tgaCTGGGAACGCGTTGAACTCACGCATCGAAACTTGGCGACCCCGCAGATCTTCCACGGAGAAGTCCAGGAACGACATGTCCTTGGCATTTTGCTCAGC
GTTGCAGCTAGTTAAGGCGGCAAGCAGCGCTACTAGCAGCAGAAGCGCGCAGCTACGCGGCGCTGTCATGGTCAGTTGCGTATCCAAAACTGTGGAGACC
GTGCCTGCTGATTGGTTAATTTGTCTAAAAGCTCATTATTcgcttctgattggctaaaataaAATATAAAAATGGCGGGGGTTCAAAGTGTTTTGGCGTG
GAATAAGGCGCGCGAAGTGACGGCCATCGCTTCGACGTGGCCTCTGCCAGTGCAAGCGAGCGGAAAGACCTGATCGTCACCAATGTCTTCTCACGATGGG
AATGAATCCACGTCCAATGGCTCCAGCTCTCGCCCGGTTCCTTCTGCATTACTAGGCAAAAAAACTCTTTTAGGCGCTCGCTCCAGTGAAGAAGCGCGTC
GGAACCGCCTCAACATGGAGAAAATGATCCTGAAGAACGTCTCTGGGGCCAGAATCAGCACCAAGAATCGTGGCCAGCAGATCGTAGAAgcactcaagaa
gaagcgacagcaagGGGACGGAGCGGAAGACGAGCGAgcgaacaagaagaagaaaactgcagcagttcccaGCGAGTCGTCCAGTGCCAGAGCTGTCGCT
GCAGGGATTTTGTCCCCTGCTCGACGTTCTTCTAATGTGGGTTtacctgttgctgctactgctggagcGACGTTCACGAGTCCTACACGTCGTCATCCTT
TCCACACACAACGAAGCCCCACACCACAACGACTAAGTCCTGCACGAGTGAGACTATCAGGAGCTCCGCTGCATTTGTCTAGTCCTGTACGACCTCCTAG
AAATCCAGTGATGGCGAGTCCTGCACGACCGAAACGCAGTGGAAATACGGCGAGTCCGTTGAGAAGAAGCGAGTTCTTGACGAGTCCGTTGCGTCATCGA
GCGTCGGCATCCCCCAAGAGACCGCTCATGTTTGATGATGTTAGTAtgactgctggagaagcagctgcttcttccacgaACAAGATTAATGGACATCCAC
CGTTGCTAGCTTCGGTGTTGGACCAAGTAGAACTTGCACCACCGGCCAAGGCGCCCAGATCGACTGCTAAGTCGCCGTTCCAGTCTTTTCAAGCCAAGTT
TAATGTTAACAGGCAGTCGCCTGGACATGTGAGAATGACCAGCAGCCCGAATACCAGCAATTCAGAGCCAGGACTGTCCGTTGTTCCCCGAAATGGCCCG
ATGATGGTTGATCTAACGCATCAGgatgaagccattgcacaaAACACTGCTTCCAACACAggcgccactgctgctgctccagccTCTTTATTTGCTGCAA
ATTCCGTAGGGGATAGTGCTACCACATCTTTAGTGTCATCGGTTCCAACTGCGGCACCGTCCGTGCCAATTCAAGTTTCGAAGCCCGTGCGCAAATTATT
CTCTGCTCGCCAGGTTGTTGCCCAGAAATCTGTTTGCTTCTCGACTGAGGGTGTTGCCTCGTCACTGGATGTGACTCCTGACGGCGAAATTATCATTGTC
GGCTTCACGGATGGTGCTGTGAGGCTGTACGAGATGGATAGCAGTGTGCCCAGCGACCGTCATGGTTATCTCTTAGGCCACATCGATGAAACATCATCGA
AGGGATATTCCAGCTTCCATCTACGCATTAAAATCTCGCCGGATGGACGATACGTCTTCGTAGGCTGTCGTCAAGGCTTGCGCGTGGTGATGACAATCAA
TCTTGATCAATATCGGACTGAGAAAGGTGCGTACATTCTATACTATGACCATACTCGTCATAATGGTCTTGATGCTATGCTAACGTGTCTGTACTGCTTC
CGTTAATTGCATTAAAAACACAGAgggcgatgaagacgagttCCAGCAATTCCAAAAACATTTTTACTCTCAGCAGAGACTAAGGGTGAGTCCTGCAAAA
CAAATTGGTGCAATAATGGATTTGTTGGTTGCTTACGATTGTCTGTGTTGGTTCTGCTAGGGCTTTGCTGATGTGACTACGTACGTACCGCCAGCCGAAA
TTACAGAGTTACAGGGACGGAAAAGGTAAAGGAGTTCGTTAGCTTTCGAAGTAATTTTTCGATCTGCCTGGCTAACGCTTGACTTATTTATCTGACTCTG
CTAAAAGGTCTGCCTACTACGTGCTTACTGGACTTGGTGTGGGCTGTTTGAATCTATGGCGTTTCATTGAGGCAGACCGGGGTCAGGATGAGCCTACTTG
GGACCATTTGCAAAATTTTGTGTCTGGAGGGAACACAGCGACGGTGGGGGCATTCTTGGTGTCAAGCAACTCACCGGGGGTTCTAGCAATCGCAGCGGCC
TCAAAGGACAAATTCCTTCGCGTCTGGCCCCTGGAATACAAAAAGTCTTCGTCTGGTTTGGCGGAGAGCAATGATGACTCCGCTAGTGATGTTGAAGAGA
TTGACTCGCTAAGTGGGGTCCACGTTGTGACGactcacttcaacatacaGAACACGTCAGAGATCTTCGCGATTCACGGACAGTACGCATACAGCATTTC
GCTCATGGGTGAAGCATACCGAATTCGCCTCCCAGATGCTGCAAACATTGCTGGTAGTGAAGGCGAGCGCCCACCTCGCCAATCCTTCGAGTTGGAGAAG
CTAGATCGTGGCGGGAGTGGCAAATCTCGTCGATCCAACATAATGCTGGAGTCATTATCTGCAACAGACGACGGGAAGGCGGTTGTCGCTGTTTCTGCAG
AGGGTATCGTATACTACTCCAACCAACTTCCAGATGTGGGTACTAGCGATGATGCAGTTCTCCGCATCATCGGCAAGAATGCATCGGAAAACACTTTATT
CAAAGCGCCCATGAAGGTGTATACGCCAATGATTACTTCAAAAGGTAATAAAACGAAGTCAGAGTCGATGATGGCTGTGGTGACGAACCCAACTGCTGAG
GACAGTGACGAATACACTGGTTACTTCAACGTCGACCCCACCGAGGTGCTTGCGGCACGATGGATGGTACCAAGTCGCGGGAAAAACTGCTGGGTGTGCG
GAGTCCGCAACGTGAGCCACTGGTCAGGCCCACCGCCTGAATCTAAGATTAAGGTGGTGAACACTGCTGCTTTAGATGCTGAGAAaaaggccaaggccaa
ggccGAGCGACGTCGGCAACGAGCTCTGAGACAAGCTGAAGAGGCTGCAGCGCGACAGTTAAGTAGTCCAGAGACCCCAACAAGCGCGAAGACCAAATCG
ACGCCACGGTCCAGTGCAAAGAAGGCCGCTGcgcagaagaagcagcaagttcaaTTGAATGCTAGCGTCCATGGCGACAGTGGCCCCACAGTTTCACGAC
CATCTTCTACCAACTCCAATAGAAAGCGCCGAACGAGCCACAacaatgatgatgaggacgaggacgaggacgaggactACACCGgtagcgacgacgacaa
ttTTGTTGCCGTCCGTGCTGTTCCTTCTGCCCCTGCTGGTCCGTCAGTCGCAACTCTGATGAACGAGCTAGAGCACTTTAAGAAGCGCAATGTTGAGATC
AAGACGGAATGGCAACGACGGTTGCAAGGTGAGCGGCAACTTCGCCGGAAATGGAAGCAGCGTGAGGATGAGTTCCTCGAGCAGTTGAACGACTCGCTAA
CGAAGCTAGATACTGCGGAAGTCGAGGTGGATCGCCTTAAAGTTTTGCTGCGCGATGCTGAGAAGCGGTTTGCGTTCGAGAAAGCGCGTGTGGAGCAGGA
TAACTCGGTGAAGGCGCGGTATGAGCAGCTCTGCGAGCAGATGAACGAAAAGATGGCACTGGTGGCCGACCAAAAGCGATTGCTAGAGCAGACGACGCGC
AGTTTGTTGACTGAGGTGGATCGTAATGTGCACGCACTCAAGAATGCGGTGGTACTGGAGAAGAGCGAGTGCGTAGTGTGCAAGGACCAGCAAGCCGTGA
CCGCCGTCGTGCCATGCGGCCACTTGTGTTTCTGCGAGCAAGACGCCGAGTCGTTTCGCCGCAACTGCACGTCCGAATACCCCACGTGTCCCATTTGCCA
GCAGGAGATTGTATCACTGCTGCGAATCTACTGAGCTATTGTAACCTGCTAAAGGAAAAAGGAAATCTCTCTGTAAGTGCTTTTTGTACTGTTGTACCTT
TATATTGAAGTGTGTCATGGCGGACATGGGTGTCGACATAATCTCTCGTTTGGATGCCATGGCTACTTTTCTGTAATCATCATGTTTACCCACCATGGTA
TTGGCAACCTGCCACTTCGGAAATGGTTCAGACTGGGCCCATGGAAAATGAATCGGTTCTACGTGTATTAAATAGTTATAAAACTTACAAACTATAGCAA
CTCCAAGTGTTCGAATACTGCTTTGGGCAGCAGCGATTACTGCAACACGCTTCACACCTAACGTGTTTTGGATCTCCTAGTTTAGGTCAATCCTAATTTT
AGGTAATCCATCCGTCTTCGGAAAAGAGCCGTTTTGTAAAGGCCATATCTCTCACCTTATTTATTGACAGTATTTCCTAATCTAGGCTTTGCCGCGTCAG
CCATCCGCGTCTAACGGATCACTTCTCCTTTGGACACGCAGAGCCCTAAGCAgcagacaacagcaaccaacTCCAGCACAAGAATGGGTGACTACGGACA
GTACGATGTGCCCAAGGCGGACGAGatgatcaacttcaaggtGGGACAGCCAGCCGCTTCCATGCTGCCTCTGGACAAGATCCGTGAGGCTGCCAACCTC
AAGTTTGCCGAGGCGGACCCCATGTTCCTGCAGTACGGCGTGATCAAGGGCTACCCCAAATTCCGCAAGACGCTGTCGGAGTTCCTGACCAAGGGATACC
AGCACCCAGTGGACCCGGAGaagctcttcgtcaccaaCGGCGTCACGGGCGGCCTGTCGCTCATCTGCTCGCTGTACCTGCAGGCTGGTGACTTGGTGTT
CATGGAGGAGCCGTCCTACTTTCTGGCTCTgagcatcatgaaggactTTAAAGTGAACGTGCGTCAGATCCGCATGGAGGAGGACGGACTGGAcatcgac
gagctcgagcgtctgctggagcgtggCATTGTGCCCAAGATGCTCTACACGATACCGACGTGCCACAACCCCACAGGCCGCACGCTCTCggtggagaagc
gcaagcgtcTCGTAGACCTCAGTGTCAAGTACggcttcatcatcattgcCGATGAAGTGTACCAGCTGCTGTCGTTCCCCCACGTGACGCCGCCCCCTCC
GATGTTCACGTTCGACAAGCACGACACTGTGCTTGCTCTGGGCAGTTTCTCTAAGATTTTGGCCCCTGCCCTTCGTCTCGGATGGATCCAAGGCTCGCAG
AAACTCTTCAGCAAAATTGAGGCGTGCGGACAGCTCGACTCCAGCGGTGGCATCAACCCCGTCATCTCGGGCATTGTGCACGCCGCCATTTCGTCAggtt
tgcagcagcaacacctggACGCCACTGTGCAGACTCTGTGGGAGCGTGCTAACACTCTGATGACGGAGCTGAAGGCTCACCTGCCAGAGGGCACGACCTT
CGAGGTCCCGGATGGTGGTTACTTTGTGCTCGTGCGTCTGCCCGAGGGCATGGACGCCAACGAACTGCTGCCTATTGCACAGAAGCACAAGGTGATGTAC
CTGCCCGGTGCCTcgttcagcaacaacatgaagaacTACCTGCGTCTCAGCTTCTCGTGGTACGACCAGAAAGATATGGGACTTGGCGCTCGTCGTCTTT
CAGACGCTATCCGCGAGTACCAGGAGGTGTTTGCTGCTAAGCAGAAGGAGGTCTCCtcggaggagaagacggcCAAGCCTGAGGGCAAGGGCGTGCGCGT
TGCTGTGCACGGCCACGACGGCCGTCTCGGCTCGCTCATCGTGACGGAGCTCGGCAAGGTGGAGGACGGCAGCGCCAGCTTTGCCGGTGCCATCGTCACC
CGCTTCGAGACTGGTGTGCAAGCCCCGGACCTCAACGATGTGGACGTTGTCATTGACGTGACGCTCCCCGCTGGCACCAAAAAGGTGATCTCGTACCTGC
GCGAGCAGAAGGACGCTGGCAAGATCAGCAAGCTGCCTGCTCTTGTGGTCGGCACCACGGGCGCTCTGCCCATGG