Description :
From Genome Similarity Track
Location :
Scaffold_53:233827- 235996
Transcript NameFunction/comments
Hyaar_Emoy2806658cell division protein ftsZ

Sequence
2169 bases(100 bases per row)
TCCAGACGGGAGTGCAAGTGTTTATTCCGCGCGCTGAATCGACCCACCGCACCACGCTCTACAGTATCTGCATGTGGTGCAGCCGACGAATCAGGAGTGG
ACCGTCAACCGCCGCTACTCGCAGTTCCTCCAGCTCCGGAAGGATATTCAGCACACATTAGCCGCCCAGAGCGCCTCGTGTGCAAACTGTGCGAGCTTCA
GTCGTGCACTCAGCCACTTTCACTTTCCAGGCAAGTCGCTTTTGCGGACGAATTCCGTTGTCCGCCATCGTGTCTCGTCGTTGCAAGACTTCCTCAAGCT
GGTGGTAGGACGCGTGTTTAACGACGTCCCCAAGTGCAGCACTTGTGGCCACGAGATTCAAAGGATGACGCGGCCATTCCTCATTCGAGGAGCACAGCCG
ATCAATGGATCCATTCTGTCCAAGATCAACAAGTCCTTGTCGCTGGACTCCTATGCTTTAGTGGACCAGCCCGTGGTGCCCGTGCCGGATCCGACACCGC
CTCTTTCCCTCACGATTGTGGGCAGGGAACTCTTTAGCGCCAGCAAATCGTCCAGCAAACCCATTTTCACACATAGTCAGAGCTCACATAGCAAGTCCAT
CTTCTCGCACAGCAAGGTCAAGCTCAGCACTGCATCGGACGGTGCATCTACCCAGCCGAACGAGTCGGAAGACCCCATCATGGATTACTCAGACAGCGAT
GAGGATGGCTATGGCTATGGCTATGGCAAGAAGTACGACGATCAGCTGTGCTACGATGAAGGGGTGCCTCTTGAAGATGCCATGAAACAGGTCGTGTTGC
CTGATGGAGCTCGTGCGACGTGTGAAGAAGTTGTTGTCCGACTCACGACGATGTGGGCCGCGTACCATCTTGACGAGGCCCTTTCATCGTTACCACCCGA
GCGGCTTTCACAACAAGCCAATTTTATCGCGATAGACGAGAAGGAGTACGCGTTTTGATGGTGTGCTGTATAGTGCATTGTCCTCCGTCTCGAAGGGTAG
CTGCTAGCTGGAATTGCCGGCGTTGTGCAAACTTATAATGAAGCAGTCCATGTCAAAATATCACTGCAGCCACCAGACGGAGATTACCGTATTCTGCCCA
CTACTGGACATCACTGCGGGCGGCAGCATACGAACCAAGTTGCTGCATTTCATTTCCACACACAAGTTTTGAGCTTTACAGCGCTCTAAGAACTTCTATA
GCTTTTCAGGATCAGCGATACCCGTGGCAACTACGGAAACGCGCACTTTACCGTCCAGCGAGTCGTCAAACGTCGAACCGAAGATTATGTTGGCGTGTGG
ATCATCGAGCTCTCGTGTTACACGTTCTGCAGCTTCGTCAACCTCAAACAGTGTCAGATCGGTGCCTCCAGTGATGTTTACAATCATGCCCTTGGCGTCC
TGCAAGTCACGAAAAAAAGGACGTTAGACAATGCAGCTCGAATGTCATTGATACAGCAAGAAGCAACTACCTTGATTGAGATATCCCCCAGAAGAGGATT
TGCCAGCGCGTCATCTGCAGCACGCAAAGCTCTGTTATAGACAGCAAACAGAACTGGTCATTAGCTGGTTGTACAGAAATAGCTAAGAATTGTAAAGCTC
ACAAACCTGTTTTCTCCGTCAGCCTCTCCGCTCCCCATCATGGCGTTTCCCATATTTTGCATCACCTACAGCGAAGTCATCGGGAATACCGCATTAGATG
ATGACTAGTCATAACTATAGCATCATTAGTGAGCGCTTAAGCTGCTTACCGACTGAACGTCAGCGAAGTCAAGATTAATAAGTCCTGGCATCACCATCAG
GTCCGATATATTCTTGACACCGTCCAGTAGCACATTGTCCGCCATTCTACACAATAGATGGAGCTTACTTGAAGTTGTCCTTCTACTCGGAGACAAACAG
ACCAATTCACGTACCGAAATGCGTCCATTAATGACGTACGTTCGTCTGACATATTGAACAGGTTCTGGTTTGGGATCACAAGCATCGTGTCTACGCTATC
CTTCAGCTCAGCAAGACCCTGCGCCGCGAGCTTTGCGCGATTGTTGCCTTCGAATCGAAACGGCTGCGACCAAAAGAGTAGCCATTAAGCACAGCACAGC
CCCAAACAAACAATTCTATAGGTCAGACATACCTTTGTGACGACGGCTACCGTAAGAACACCAGCATCC