Description :
From Genome Similarity Track
Location :
Scaffold_317:2338- 3421
Transcript NameFunction/comments
Hyaar_Emoy2813737hypothetical protein
Hyaar_Emoy2813736hypothetical protein

Sequence
1083 bases(100 bases per row)
CCAGCCAGCGAGCCGGACAGACAAACAGACAGACAGACAGACAGACAGACAGACAGACAGATAGACAGATAGATAGATAGATAGATAGATAGATAGACAG
ATAGACAGACAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAG
ATAGATAGATAGATAGATAGAAAGTAAGATTTTAAAGGCTGGTGTTCACCTTGCGCATAGTCACTAATAGCATGAGCCTTCGGAATTGCAATCGTCTGTG
TAAAGGAAAGGAGAGAGAGGGGTTTAGAACTTATATTTCAATAGCTTAAAGCTATGTGCAAGATCTCTGGTATATCCTAAGCCAGGACGTAAGCGCCGGG
GGCCCGAGGGATCTTCTTGGCCGGTGCCAATTAATACTGGTAACCCTCTTGGTTCGCGTTCCAGCAACTCGATGCATGCAAAAAGCACGGCTTCCGTAAC
TTCTAACGCTACTTTTCGATACTGCCGATTTGCTATCGCCCGGAGCTTGCGGATGCACGAGGCTCAAAAACTATCGGTGCTCCTAGTAATATCGATAGTC
TCTGCTCGGAAGACTGCTGAATCTCGGTATACCCAGATCCACGTTTGGCACATCATCGCTAGAATGTGCCATATGTCCTTCCATACTCGGGTGGACACGG
CCACGTCGTCTTGAAAACGGTCTGTAAGGAGTGTCATCCAATGAGACGGTGTCCCGTGGATCCGTCTGCTGGCGCAGGCGTCCAGAAAATGTTGGATTCG
TCGGCAGGACGATAGTTTCCTGGTCCAGTGCTCAATTTGTTTAACTTAAAAAGCAGCGGCACTTTTGCACTCCCAGAAGAGATACCCCATAGTCTCCACA
CATCCATGACATGCTGGTGCCTTCCTGCAACTGATTTCCTCATGACACAATGCTTGGTACAGGTTGAGCTGGCGCGTCGCTACCCGGTACCCAGTGCAGA
CTCGATAAGGAGAAAGGCCATGACAATGGTCCCAAACTTGACGCGGAGATTATCGGAGCGCAGCGCGTTACCATTCGTCGGCG