Description :
From Genome Similarity Track
Location :
scaffold_221:23379- 24754
Transcript NameFunction/comments
g5878.t1hypothetical protein
g5879.t1 hypothetical protein PHYSODRAFT_490913

Sequence
1375 bases(100 bases per row)
CGGCCTCGACAGCCCCTCATCGTGTGTGCGAGCTTGGTGGACAAGATCCCCAACCTGGCAGGACTCGCGCGTACCTGCGAGATCTTCAACGCTCAGAAGT
TGATCGTGCCGAACCTTCGTACGGCCGAAAAGGATGCTACGTTTGCCACTGTGAGCGCTACAGCTCACAAGTGGATGCCGTTGGAAGAGGTCCGACCTCA
AGGTAGTGACCTCCGTGACGCTCTTCTTCGCTGGAAGGACGAGAGCTACACTATCGTGGCTGTCGAGCAAACAGCTTCCAGTGTGAGCCTTGCAAACTAT
ACGCTGCCACGCAAGATGGTGCTTGTTCTGGGTCGTGAGAAGGAGGGGATCCCGGTGGATGTTCTGCAGCTCGTGGACGTATGTGTTGAAATCCCTCAAT
TCGGTTTGGTACGCTCGTTAAACGTGCACGTGAGTGGAGCGTTAATGCTGTGGGAGTACACGCAGCAGCAATTGATGTCTGGCGCTCTCAAGTCGACACT
ATAGTCGTTGAAGCTTTTTAAGTGCTGATGTAGATAATAAGGCTGGATTGAATAGAGATCACGATGGGAACAAGTTGCAGAGCTGTGAGCTGGCGTCAAC
AAATGCCAAATGTAATCATGCGGGACTGTTTCGTGCAACAGATGGAGATATGCACGTACATTCTGAACCAGCGTTTGTTTTTGAGAGTACTATGATAAGC
TCACTTTCCTTTTTGCCTTCACTCAGGTACTCTCAATGACCAAGGTTTATATTCGTCCGCGTCCGTTCGCTTCGTCTGAGAAAGATGAAGAAGTCATCGA
GTACGTCGCAGACAAAAGCGGGAACATCCACGTAGTGACTGCTGACAAGAAGTTCCCGCACTTTGCTGGCATTCTTTCACCAGAAAACAGTGAAGCGTAT
GCTCAATCGATCCACCCCATGGTGCCGGCAATGCTGACTGGTGCAACGTCGTGCTGTTTCGCGTACGGCCACACGAGCAGTGGAAAGACCCATACGATCT
TCGGATACGGTGCTGAGCTCGGTATGTGCCAGCGGTTAGTTCAAGATCTGTTTGCAGAGAGTGAGGGAGATCTACTCGTGCAAGTCCGCTTCTACGAGCT
GTACAACGGCCAAGTGTTCGACTTGCTGAACGAACGCCAGCCAGGGTTTGTACGTGAAGATGCGGATGGAGTGATTCACGTTCGAAGTGCCACAACAATG
GGACCCCAAGGTGAAGTACTGACTCAGTCTTTAAAAGCAGACTATGGTGGCTCTGCTGAAGCTGTGCTTGAAATCATTCGCCAAGGGAGGAGTCGTCGTG
CAGAGGGGACGTCGGAGCTGCACCAGCAAAGCAGTCGGTCTCATGCAGTTCTAGAGCTCGAGATTGTGACTACAG